ID: 1060791481

View in Genome Browser
Species Human (GRCh38)
Location 9:126488540-126488562
Sequence TTCCTCCCACGTGGTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060791481_1060791489 -2 Left 1060791481 9:126488540-126488562 CCCTCTGCACCACGTGGGAGGAA No data
Right 1060791489 9:126488561-126488583 AAGGGGGGTCCACCCATTTACGG No data
1060791481_1060791494 28 Left 1060791481 9:126488540-126488562 CCCTCTGCACCACGTGGGAGGAA No data
Right 1060791494 9:126488591-126488613 GACTCAAGAAGTTAAGTGACTGG No data
1060791481_1060791490 6 Left 1060791481 9:126488540-126488562 CCCTCTGCACCACGTGGGAGGAA No data
Right 1060791490 9:126488569-126488591 TCCACCCATTTACGGAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060791481 Original CRISPR TTCCTCCCACGTGGTGCAGA GGG (reversed) Intronic