ID: 1060794495

View in Genome Browser
Species Human (GRCh38)
Location 9:126504798-126504820
Sequence CCCCCACCAGGGGCATCCTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 272}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060794495_1060794510 27 Left 1060794495 9:126504798-126504820 CCCGAGGATGCCCCTGGTGGGGG 0: 1
1: 0
2: 0
3: 22
4: 272
Right 1060794510 9:126504848-126504870 CAGCAGCAGGACCTTGTCATGGG 0: 1
1: 0
2: 0
3: 16
4: 222
1060794495_1060794503 -2 Left 1060794495 9:126504798-126504820 CCCGAGGATGCCCCTGGTGGGGG 0: 1
1: 0
2: 0
3: 22
4: 272
Right 1060794503 9:126504819-126504841 GGTGGCCTTCTCAGGACTCCTGG 0: 1
1: 0
2: 1
3: 30
4: 205
1060794495_1060794507 14 Left 1060794495 9:126504798-126504820 CCCGAGGATGCCCCTGGTGGGGG 0: 1
1: 0
2: 0
3: 22
4: 272
Right 1060794507 9:126504835-126504857 CTCCTGGGTGGCACAGCAGCAGG 0: 1
1: 0
2: 2
3: 27
4: 299
1060794495_1060794505 2 Left 1060794495 9:126504798-126504820 CCCGAGGATGCCCCTGGTGGGGG 0: 1
1: 0
2: 0
3: 22
4: 272
Right 1060794505 9:126504823-126504845 GCCTTCTCAGGACTCCTGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 217
1060794495_1060794502 -10 Left 1060794495 9:126504798-126504820 CCCGAGGATGCCCCTGGTGGGGG 0: 1
1: 0
2: 0
3: 22
4: 272
Right 1060794502 9:126504811-126504833 CTGGTGGGGGTGGCCTTCTCAGG 0: 1
1: 0
2: 2
3: 13
4: 254
1060794495_1060794504 -1 Left 1060794495 9:126504798-126504820 CCCGAGGATGCCCCTGGTGGGGG 0: 1
1: 0
2: 0
3: 22
4: 272
Right 1060794504 9:126504820-126504842 GTGGCCTTCTCAGGACTCCTGGG 0: 1
1: 0
2: 0
3: 18
4: 216
1060794495_1060794509 26 Left 1060794495 9:126504798-126504820 CCCGAGGATGCCCCTGGTGGGGG 0: 1
1: 0
2: 0
3: 22
4: 272
Right 1060794509 9:126504847-126504869 ACAGCAGCAGGACCTTGTCATGG 0: 1
1: 0
2: 1
3: 19
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060794495 Original CRISPR CCCCCACCAGGGGCATCCTC GGG (reversed) Exonic
900140608 1:1137993-1138015 CTCCCACCAGGCACATGCTCAGG + Intergenic
900540422 1:3199954-3199976 CCCCCACCAGGGGAATGCAGAGG + Intronic
900564327 1:3324910-3324932 GCACCACCAGGGGCGTCCGCTGG - Intronic
900980164 1:6041686-6041708 CCCCCACCAGTCGCCTGCTCAGG - Intronic
905213112 1:36387953-36387975 CAACCCCCAGGGGCTTCCTCAGG + Intergenic
905279716 1:36841372-36841394 CCCATAGCTGGGGCATCCTCTGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906035182 1:42746450-42746472 CCACCCCCAGGGGCCTCCACAGG - Exonic
906198739 1:43946401-43946423 CCGCTGCCGGGGGCATCCTCCGG - Intergenic
907619219 1:55959322-55959344 CCACCATCATGGGCCTCCTCTGG + Intergenic
912778938 1:112526071-112526093 CCCCAACCCTGGGCATCCTCAGG - Exonic
923437848 1:233984770-233984792 CCCCCACCAAAGACATCCACTGG - Intronic
923541735 1:234893157-234893179 CCAGCAGCAGGGGCATCCCCTGG - Intergenic
924828018 1:247562353-247562375 CCTCCACCACATGCATCCTCTGG - Intronic
1062957875 10:1552174-1552196 CTCCCCCCATGGGCATCCTGGGG - Intronic
1067279921 10:44863495-44863517 CCCCCACCAGGTGGCTCCCCTGG + Intergenic
1070383244 10:75900616-75900638 ACCCCTCCAGGGGCATGCTGCGG - Intronic
1071468165 10:85959538-85959560 CCCCCACCCGAGGCAACCACTGG + Intronic
1073179447 10:101574982-101575004 TGCCCTCCAGGGGCAACCTCGGG + Intronic
1073442488 10:103560641-103560663 CCCCCACCCTGGGCATGCACAGG + Intronic
1074357163 10:112796617-112796639 CCCACACCAGGGCCAACCTGGGG - Intronic
1074536086 10:114329463-114329485 GCCCCACCAGGGGCAGCTGCTGG - Intronic
1076086097 10:127633723-127633745 CCCCCACCAGGTCCCTCCCCTGG + Intergenic
1076156814 10:128211005-128211027 CCTCCCCCGGGCGCATCCTCCGG + Intergenic
1076421465 10:130335203-130335225 CCCGCTCCAGGGGCACACTCGGG + Intergenic
1076506044 10:130973305-130973327 CGTCCACCAGGGCCATCCTGGGG - Intergenic
1076599583 10:131648114-131648136 CCACCTGTAGGGGCATCCTCAGG + Intergenic
1076716851 10:132370404-132370426 CCCACCTCATGGGCATCCTCTGG - Intronic
1076847446 10:133076239-133076261 CCCCCACCTTGGGCACCCTCAGG + Intronic
1077352670 11:2100106-2100128 CCCCCACCCAGGCCAGCCTCAGG - Intergenic
1077373069 11:2192672-2192694 CCCCCACCAAGGGCCTGGTCTGG + Intergenic
1077419476 11:2443923-2443945 CCCCACCCAGGGGAATCCACGGG + Intergenic
1077480243 11:2811198-2811220 TTCCCACCAGGGGCTTCCTGGGG - Intronic
1077551954 11:3204387-3204409 CCCCACCCACGGGCAGCCTCCGG - Intergenic
1077765081 11:5149932-5149954 CACCCACCTGGTGGATCCTCTGG - Intergenic
1078297288 11:10085970-10085992 CCCCCACCCCAGGTATCCTCAGG + Intronic
1079460446 11:20673548-20673570 CCCCCACCCAGGGAATGCTCGGG - Intronic
1083996632 11:66276277-66276299 CCCCCTCCAGGGACATCATCTGG - Exonic
1084311475 11:68318755-68318777 CCCCCACCAGGCACCTTCTCAGG - Intronic
1084501446 11:69537960-69537982 CCCCCAACATGGCCATCCTCTGG - Intergenic
1084518056 11:69647014-69647036 CCCTCACCTGGGGCTTCCTGGGG - Intronic
1085402159 11:76241661-76241683 CCACCGCCCGCGGCATCCTCTGG + Intergenic
1089638935 11:119834178-119834200 GCCCCACCTGGGCCATCCTTAGG - Intergenic
1089705711 11:120276139-120276161 CCACAACCAGGAGCAGCCTCAGG + Intronic
1091464149 12:669258-669280 CCACCACCAAGAGCATCCCCAGG - Intergenic
1091848661 12:3677818-3677840 CCCCCACCAGGATCTTCCCCAGG + Intronic
1092048736 12:5452738-5452760 CCCCCACCTAGGGCAGCCTTGGG + Intronic
1092988028 12:13865825-13865847 CCCCCATCCTGGGCATCCACGGG - Exonic
1095960735 12:47832881-47832903 CCCCCAGCAGGGCCCTCCTCTGG - Intronic
1097675067 12:62591353-62591375 CCCCAAACAGGGGCTTCCTCAGG - Intronic
1099369396 12:81811631-81811653 CTCCCCCCAGGGGCTCCCTCTGG - Intergenic
1103468989 12:121165063-121165085 CTCCCACCAGGCCCCTCCTCTGG + Intronic
1103931925 12:124455375-124455397 CCCCCTCCAGGCACATCCTCGGG - Intronic
1104384933 12:128342509-128342531 CCTCGGCCAGGGGCATCCACTGG - Intronic
1104720016 12:131040037-131040059 ACCCCACCAGCGGCACCCTCAGG + Intronic
1104930963 12:132339295-132339317 GCCCCACCTGGGCCAGCCTCCGG + Intergenic
1105206527 13:18230514-18230536 CCCTCACCAGAGCCATCCCCGGG + Intergenic
1105240231 13:18601218-18601240 GTCCCACCAGGGGCCTCCACTGG + Intergenic
1107610486 13:42107837-42107859 CCCCCATCAGGGGCATACCAGGG - Intronic
1108457628 13:50632456-50632478 CCCTCCCCAGAGGCAACCTCTGG - Intronic
1113030834 13:105991979-105992001 CTCCTTCCAGGGGCATCCACTGG + Intergenic
1113205059 13:107907524-107907546 CTCCCACCAGGCCCTTCCTCCGG - Intergenic
1113789629 13:113021500-113021522 ACAGCACCAGGGGCAGCCTCCGG - Intronic
1115336459 14:32247811-32247833 CCCTACCCAGGGCCATCCTCTGG - Intergenic
1117374925 14:55111325-55111347 CCTCCACCAGGGGCTTGCTGTGG + Intergenic
1117555297 14:56877581-56877603 CACCCACCAGGCACATCCTTGGG - Intergenic
1120171031 14:81247494-81247516 CGCCCACAAGGGGCAGCCTGCGG + Intergenic
1120951929 14:90049592-90049614 TCCCCATCAGGGGCAGCCCCAGG - Intergenic
1122413844 14:101539254-101539276 CCCCAACCAAGTGCATCCCCAGG + Intergenic
1122470410 14:101962301-101962323 CCCCCACCAGGGTCAGCTTGGGG + Intergenic
1122864456 14:104597246-104597268 CCCCCACCAGCAGCACCCCCCGG + Intronic
1123033417 14:105461760-105461782 CCCCCAGCAGATGCGTCCTCAGG - Intronic
1202900232 14_GL000194v1_random:32256-32278 GCTCCACCAGGGTGATCCTCAGG + Intergenic
1123491002 15:20782867-20782889 GTCCCACCAGGGGCCTCCACTGG - Intergenic
1123547504 15:21351958-21351980 GTCCCACCAGGGGCCTCCACTGG - Intergenic
1123919352 15:25059697-25059719 CCACCACCCAGGGCATCCGCAGG + Intergenic
1126243378 15:46472570-46472592 CCCACACCAAGGCCATACTCTGG - Intergenic
1127545837 15:59993961-59993983 CCACCACCTGGGCCACCCTCAGG - Intergenic
1129376845 15:75138899-75138921 CCTGCACCAGGAGCAGCCTCGGG + Intergenic
1129653868 15:77510083-77510105 CCCCCCACAGGGGCATCTGCGGG + Intergenic
1129986347 15:79923063-79923085 GCCCGACCAGAGGGATCCTCCGG + Intronic
1130996464 15:88907167-88907189 CCCGCCCCAGGGCCATCCCCAGG + Intronic
1132333602 15:101029128-101029150 TCCCCACCAGCAGCATCCTGAGG - Exonic
1202955834 15_KI270727v1_random:79188-79210 GTCCCACCAGGGGCCTCCACTGG - Intergenic
1133842401 16:9421575-9421597 CCCCCAACAGGCGCATATTCTGG + Intergenic
1136082267 16:27860025-27860047 CTCCCAGCAGGGGCTCCCTCTGG + Intronic
1136143412 16:28301470-28301492 TCCCCACCAGGGGCAGTCTGGGG - Intronic
1136494199 16:30631928-30631950 CTTCCACCAGGGACTTCCTCTGG - Intergenic
1137392566 16:48093443-48093465 CTCCCAGCAGAGGCCTCCTCTGG + Intronic
1137726581 16:50660730-50660752 TCCCCACCTGGGGAATGCTCTGG + Intergenic
1138620288 16:58205816-58205838 TCCCCCTCAGGGGCATTCTCTGG - Intergenic
1140347889 16:74232802-74232824 CTGCCACCAGGGGCATCATTAGG - Intergenic
1141426130 16:83945906-83945928 CCCCAACCAGGGTCATCAGCAGG + Intronic
1142848724 17:2694290-2694312 CCCCCACCACAGGAAGCCTCAGG + Intronic
1143260452 17:5594747-5594769 GCACCACCAGGCACATCCTCAGG + Intronic
1143705634 17:8696125-8696147 CCCCAACCTGGGGCATTCTCCGG - Intergenic
1145818144 17:27810371-27810393 CCCCCTCCAGGGCCTTCCACAGG - Intronic
1146275299 17:31512439-31512461 CCACCCCCAGGGGCCTCCTGGGG + Intronic
1147864543 17:43544161-43544183 GCCCCACCAGCGACACCCTCAGG + Intronic
1149531346 17:57397715-57397737 CTCCCGCCAGGGGCATGCTGGGG - Intronic
1151165185 17:72197538-72197560 CCCCAACCAGTGGCATTCACAGG + Intergenic
1151659332 17:75510272-75510294 CCCCCACCCGGGTCCTCTTCAGG - Intronic
1151700033 17:75737907-75737929 CCTCCATCAGGGTCCTCCTCAGG + Intronic
1151871817 17:76841738-76841760 CCCCCTCCAGCAGCGTCCTCCGG + Intergenic
1151975243 17:77480677-77480699 CACCCAGCAGGGGCAGCCACAGG - Intronic
1152256347 17:79242217-79242239 CCCCCACCCCGGGGCTCCTCAGG - Intronic
1154448599 18:14457556-14457578 GTCCCACCAGGGGCCTCCACTGG - Intergenic
1155230848 18:23773560-23773582 CAGCCATCAGGGGCATCCACTGG - Exonic
1156266187 18:35490409-35490431 CCCCCACTAGGGACAACTTCAGG + Intronic
1158004165 18:52652896-52652918 CCCCCACCAGGAGCTTGCTTAGG + Intronic
1158538557 18:58330798-58330820 CCCCCACCACCGGCCTCCCCAGG + Exonic
1160543352 18:79637763-79637785 CCCCGGCCAGGGGCTGCCTCTGG + Intergenic
1161089489 19:2352882-2352904 CCCCTGCCAGGGTCCTCCTCTGG + Intronic
1161234965 19:3193197-3193219 CCCCCACCAGGGACAGTCACTGG + Intronic
1163485413 19:17582764-17582786 CCGCCACCAGGGGCAAGCACAGG + Exonic
1163628013 19:18402045-18402067 CCCCCACCACCTGCAGCCTCGGG - Intergenic
1164996096 19:32720833-32720855 CCCCCACCAGGGGGCACCCCGGG + Intronic
1165204419 19:34172008-34172030 CCAGCTCCAGGGGCAGCCTCGGG + Intergenic
1166300114 19:41908352-41908374 TTCCCACCAAGGGCAGCCTCTGG + Intronic
1166340783 19:42135372-42135394 CCCAGGCCAGGGGCAGCCTCTGG + Intronic
1166862000 19:45816328-45816350 CTCCCAGCAGGAGCATCCCCTGG + Intronic
1167116838 19:47493334-47493356 TTCCCACCAGGGGAGTCCTCTGG - Intronic
1167293281 19:48635891-48635913 GCCCCAGCCGGGGCATCCGCCGG + Exonic
1167448734 19:49554957-49554979 CCCCCACCTGTGGCAGCCTGAGG - Intergenic
1202647248 1_KI270706v1_random:153407-153429 GCCCCACCAGGGTGACCCTCAGG - Intergenic
925025935 2:607300-607322 TTCCCACCTGGAGCATCCTCTGG - Intergenic
925442502 2:3900578-3900600 CCTACACCAGGGACATCCCCAGG - Intergenic
926121307 2:10242647-10242669 CTCCCTCCAGGAGCTTCCTCTGG + Intergenic
926210968 2:10869041-10869063 CCCCCAGAGGGGCCATCCTCGGG + Intergenic
927187168 2:20490214-20490236 CCTCCAGCAGCAGCATCCTCTGG - Intergenic
927872573 2:26632975-26632997 CCCCCACCACGGGCACCACCGGG + Intronic
927888172 2:26731075-26731097 CCCCCACCCCGGGCAGCCCCCGG + Exonic
928398882 2:30964046-30964068 ACCCCATCAGGGGCTTCCTCTGG - Intronic
928438203 2:31269677-31269699 CACCCTCCAGGGGCTGCCTCAGG - Intergenic
930737609 2:54795410-54795432 CCCCCACCAGGCCCCTCCTCTGG + Intronic
932053962 2:68425951-68425973 CCACCACCAGCAGCATCCCCTGG + Intergenic
932117656 2:69067817-69067839 CCCCCACCAAGGCCATGCTGGGG - Intronic
932441969 2:71743283-71743305 CATCCACCAGAGGCATCCCCTGG + Intergenic
933832272 2:86220482-86220504 CCCACACCAGGTGAATGCTCAGG + Intronic
935056656 2:99573464-99573486 CCCCCACCAGGGGCTTGCAGTGG - Intronic
935592680 2:104856044-104856066 CCCACACCAGGGCCACCCTGGGG + Exonic
937325926 2:120989546-120989568 CCCCCTCCCAGGGCATCCCCAGG + Exonic
943843688 2:192613258-192613280 GCCCCATCTGGGGCATCGTCAGG + Intergenic
946404513 2:219485160-219485182 CACCCACCAGGGGCAGGCTGAGG + Intronic
948749602 2:240124156-240124178 CCCCCGCTGGGGGCAGCCTCTGG + Intergenic
948760465 2:240187215-240187237 CCCCCACCTTGGGCATACCCTGG - Intergenic
948893845 2:240919213-240919235 CCCCCCACAGGGCCACCCTCAGG + Intronic
949023084 2:241752299-241752321 CCCAGCCCAGGGGCGTCCTCTGG + Intronic
1168793550 20:596110-596132 CCCCACCCAGGGGCCTCCCCAGG - Intergenic
1169072609 20:2742628-2742650 CACCCTCCATGGGGATCCTCAGG + Intronic
1169316044 20:4592108-4592130 CCCCTGCCAGGGGCATTCCCAGG + Intergenic
1171055761 20:21904680-21904702 CCCTTCCCAGAGGCATCCTCTGG + Intergenic
1171326920 20:24302800-24302822 CCCCCACGAGGGGTGTCCCCAGG + Intergenic
1173454542 20:43191726-43191748 TCCCCACCCGGGTCATCCCCTGG - Intergenic
1173704720 20:45101200-45101222 CTACCTGCAGGGGCATCCTCCGG + Intergenic
1174415381 20:50362967-50362989 CCCCCACCAGGGACATACCAGGG + Intergenic
1174787541 20:53446746-53446768 GCCTTACCAGGGGCATCCACTGG - Intronic
1175953091 20:62593820-62593842 CCCCAACCTGGGGCATCCTTTGG + Intergenic
1176120097 20:63450417-63450439 CCCACACCTGGGGCAGCCCCAGG - Intronic
1176447632 21:6832959-6832981 GTCCCACCAGGGGCCTCCACTGG + Intergenic
1176604622 21:8819367-8819389 GCCCCACCAGGGTGACCCTCAGG + Intergenic
1176619604 21:9047034-9047056 GCTCCACCAGGGTGATCCTCAGG + Intergenic
1176825801 21:13697985-13698007 GTCCCACCAGGGGCCTCCACTGG + Intergenic
1178535035 21:33403790-33403812 CCCCCACCTGGGGCACCCGCAGG - Intronic
1179469040 21:41598256-41598278 CCCTCACCAGGGGTGCCCTCTGG + Intergenic
1179479298 21:41667404-41667426 CCCCCACCAGAAGCAGCCTGGGG + Intergenic
1179712076 21:43269110-43269132 CCCCCACCAGAGGCGTGCCCGGG - Intergenic
1179799157 21:43802857-43802879 CCCTCACCAGGGGCAACCCTGGG + Intronic
1180346911 22:11710972-11710994 GCCCCACCAGGGTGACCCTCAGG + Intergenic
1180354660 22:11829062-11829084 GCCCCACCAGGGTGACCCTCAGG + Intergenic
1180383591 22:12163270-12163292 GCCCCACCAGGGTGACCCTCAGG - Intergenic
1180759425 22:18188194-18188216 CCCTCACCAGAGCCATCCCCGGG - Intergenic
1180769735 22:18372494-18372516 CCCTCACCAGAGCCATCCCCGGG - Intergenic
1180776594 22:18490172-18490194 CCCTCACCAGAGCCATCCCCGGG + Intergenic
1180809322 22:18747541-18747563 CCCTCACCAGAGCCATCCCCGGG + Intergenic
1180827672 22:18875450-18875472 CCCTCACCAGAGCCATCCCCGGG - Intergenic
1181052893 22:20246090-20246112 CAGCCAGCAGGGCCATCCTCCGG - Intronic
1181072243 22:20352522-20352544 CCCTCACCAGAGCCATCCCCGGG + Intronic
1181195317 22:21181463-21181485 CCCTCACCAGAGCCATCCCCGGG + Intergenic
1181214130 22:21311311-21311333 CCCTCACCAGAGCCATCCCCGGG - Intergenic
1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG + Intronic
1181585126 22:23849006-23849028 CCTACACCAGGGGCCTCCTGCGG - Intergenic
1181810078 22:25398634-25398656 CCCCCACCAGGCACCTTCTCAGG + Intronic
1182144866 22:27991167-27991189 CCACCACTGGGGGCAGCCTCGGG + Intronic
1182299609 22:29330302-29330324 CCTCCACCAGGGCCACCCCCTGG + Intronic
1182300671 22:29335215-29335237 CATCCACCAGCGGCATCCTGTGG + Intronic
1182763887 22:32744763-32744785 CCACCACCAAGGGCAAGCTCAGG + Intronic
1183742648 22:39677431-39677453 CCCCCACCACGGGCCTGCTCTGG - Intronic
1184095826 22:42315754-42315776 CCTCCACCTGGGGCTACCTCTGG - Intronic
1184104639 22:42360269-42360291 CCCCAAGGAGGGGCATCCCCAGG - Intergenic
1184755846 22:46515257-46515279 CCCCCACCTGGGCCCTCCTGGGG + Intronic
1184887168 22:47353559-47353581 CACCCAGCAGGGGAATCCACTGG - Intergenic
1203231564 22_KI270731v1_random:113678-113700 CCCTCACCAGAGCCATCCCCGGG - Intergenic
1203277772 22_KI270734v1_random:101447-101469 CCCTCACCAGAGCCATCCCCGGG - Intergenic
950228906 3:11259112-11259134 CCACCACCAGGGGCATCAGCTGG - Exonic
950525174 3:13519027-13519049 GCCCCTCCAGGGTCAGCCTCGGG - Intergenic
950671925 3:14532440-14532462 CCCCCACCACAGGAATCATCTGG - Intronic
951806540 3:26650468-26650490 CCCCCACCAGTGGCAGACTGAGG + Intronic
951962992 3:28349244-28349266 CCCCCTTCAGGGGCGCCCTCTGG + Intronic
952403757 3:32987136-32987158 CTCCCACCAGTGGCAGCCTGCGG + Intergenic
952818941 3:37469190-37469212 TCCCCAGCAGGAGCATCCCCCGG - Intronic
952968564 3:38636623-38636645 CGCCCACCAGGAGCAGCCTGGGG - Intronic
954107161 3:48415582-48415604 GCCCCACCAAGAGCTTCCTCAGG - Exonic
954989878 3:54831499-54831521 TCCCCACCATGGGCAACCACTGG + Intronic
956481234 3:69675784-69675806 CCCCTCCCAGGAGCAGCCTCAGG - Intergenic
958270323 3:91491470-91491492 CTCTCACCAGGTGCACCCTCTGG + Intergenic
960971416 3:123142694-123142716 CCCAGCCCAGGGGCAGCCTCTGG + Intronic
961664855 3:128488715-128488737 CCCTCACCAGAGGCCACCTCGGG - Intronic
961823471 3:129586909-129586931 CCCCCACCAGGAGCTCCTTCTGG + Intronic
961999349 3:131278848-131278870 CCTGCACCAGGGACATCATCTGG + Intronic
963051863 3:141149827-141149849 GCCCCAGGAGTGGCATCCTCAGG - Intergenic
963850730 3:150208001-150208023 CACTCACCAGGGGCAACCACAGG - Intergenic
964461015 3:156928345-156928367 CCCCCACTAGGGACACCCTGTGG - Intronic
965738524 3:171848272-171848294 CCAGCAGCATGGGCATCCTCTGG - Intronic
966692157 3:182753280-182753302 CCCCAACCAGGGCCATTCACAGG + Intergenic
966782083 3:183592716-183592738 CCCCCACCAAAGGGATCCACTGG + Intergenic
968486797 4:866812-866834 CCTCCCCCAGGAGCAGCCTCGGG - Intronic
969415114 4:7052942-7052964 CCCACAGCTGGGGCTTCCTCTGG - Intronic
969437007 4:7194058-7194080 GCCCCACCAGGGGCTGCCCCAGG - Intronic
970108963 4:12616555-12616577 TCCCCAGCAGGGGCAGACTCTGG - Intergenic
973004291 4:44989663-44989685 CCCTACCCAGGGTCATCCTCTGG + Intergenic
973373503 4:49271570-49271592 GCCCCACCAGGGTGACCCTCAGG - Intergenic
973387510 4:49523638-49523660 GCCCCACCAGGGTGACCCTCAGG + Intergenic
973938630 4:55879452-55879474 CCCCCACCAGGGTCTGCCCCTGG - Intronic
974385992 4:61202118-61202140 CCCCCACCAGGGGATGCCACTGG - Intronic
979751038 4:124278720-124278742 CCCCCACCAGATGGCTCCTCTGG - Intergenic
982122819 4:152158789-152158811 CCTCCACCAGAGCCTTCCTCAGG + Intergenic
983534120 4:168839321-168839343 CCCCCAACAGGGGCACCATCTGG - Intronic
985870148 5:2548054-2548076 CCCTCACCAGGAGCATCTCCAGG - Intergenic
985967936 5:3351916-3351938 CACCAAGCAGGGGCAGCCTCAGG + Intergenic
987091187 5:14509076-14509098 CCACCACCTGGGGCTTCCTCTGG + Exonic
987853481 5:23387604-23387626 CCCCCACCAAGTGGATCCACCGG + Intergenic
993317459 5:86428970-86428992 CCCGCACCAGGAGCCTCCTGGGG - Intergenic
997795000 5:136800265-136800287 TCCCTACCAGTGGCTTCCTCTGG + Intergenic
999153723 5:149443081-149443103 CCGCCACCAGGGGCATGGGCTGG + Intergenic
1001757124 5:174179171-174179193 CTCCCACCAGTGGTATCATCAGG - Intronic
1002430263 5:179199295-179199317 CCCCCAGCAGGGGCAGGATCAGG + Intronic
1003950193 6:11109390-11109412 CCCTACCCAGGGCCATCCTCTGG - Intronic
1005946992 6:30602370-30602392 CCCCCACCAGGGCCTTCGTGAGG + Exonic
1006377999 6:33682464-33682486 CCCCCACCCTGGGCAACCCCAGG - Intronic
1007415833 6:41690760-41690782 CCCCCACCAGCCGCCTCCCCAGG - Exonic
1011657719 6:89566594-89566616 CCCCTATCAGGGACATCCTCCGG - Intronic
1012818722 6:104057798-104057820 CCCCCAACTGGGGCCTCCCCAGG - Intergenic
1017250046 6:152270702-152270724 TCCCCACCAGGGCCCTCATCTGG - Intronic
1017819484 6:158038964-158038986 CCCCCACCAGGCCCATGCCCTGG - Intronic
1017929528 6:158939705-158939727 CTCCCACCTGGGTCAGCCTCCGG + Intergenic
1018807074 6:167270034-167270056 CCCCCACCCCGTGCAGCCTCTGG - Intergenic
1018869430 6:167769978-167770000 TCCACACCAGGGGCCTCCTTTGG - Intergenic
1018908573 6:168089075-168089097 CCCACACCAGGGCCATACACAGG + Intergenic
1023943399 7:44784725-44784747 CCCTCCCCAGGGGCACTCTCAGG + Intergenic
1025023781 7:55499497-55499519 TCCCCAGCAGGGGTTTCCTCTGG - Intronic
1026834090 7:73626742-73626764 CACCCACTAGGGACATCCTTGGG - Intergenic
1027051449 7:75023943-75023965 CCCCAACCAGGAGCCTTCTCTGG - Intronic
1028832819 7:95345129-95345151 CCCTAACCAGGGCCATCCTCTGG + Intergenic
1029969238 7:104773146-104773168 CCCCCACCAGGGGACTTCTCTGG - Intronic
1033232968 7:139616085-139616107 CCCCCAGCAGGGACACCCACAGG - Intronic
1034150403 7:148910642-148910664 CAGCCTCCAGGGGCCTCCTCAGG + Intergenic
1034436038 7:151063174-151063196 CCCCCACCTGAGTCATCCTGCGG - Intronic
1035022297 7:155806902-155806924 GACCCTCCAGGGGCACCCTCTGG + Intronic
1035197228 7:157231728-157231750 ACCTCACCAGGGGCTGCCTCTGG + Intronic
1038578049 8:28722269-28722291 CACCCTCCAAGGGCATCCTAAGG - Intronic
1041127715 8:54661636-54661658 CCCACACCAGCTCCATCCTCTGG - Intergenic
1041375146 8:57204807-57204829 CCCCCACCAAGGGAAGCATCAGG - Intergenic
1042268781 8:66935353-66935375 CCCCCACCAGGTGGATCTGCTGG - Intergenic
1042344257 8:67711553-67711575 CCCCAACCAAGAGCCTCCTCAGG - Intronic
1049197244 8:141322652-141322674 CCCACACCTGGAGCACCCTCAGG + Intergenic
1049614891 8:143571809-143571831 TCCCCACCAGGTGCATGCTCTGG - Exonic
1049663465 8:143831072-143831094 CCACCACCAGGGGAAGCCACAGG + Intergenic
1049813250 8:144585712-144585734 CCACAACCAGCGACATCCTCGGG - Intronic
1051889060 9:21924733-21924755 CCCTACCCAGGGCCATCCTCTGG + Intronic
1055401895 9:75932933-75932955 CCCACACCATTGGCAGCCTCAGG + Intronic
1057371817 9:94480333-94480355 CCTCCAACAGGGGGCTCCTCCGG - Intergenic
1059269171 9:113061335-113061357 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059270306 9:113066784-113066806 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059271442 9:113072234-113072256 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059272573 9:113077678-113077700 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059273708 9:113083120-113083142 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1059274843 9:113088566-113088588 CCGCCAGCTGGGCCATCCTCTGG - Intergenic
1060661902 9:125409361-125409383 CCCCCTCCAGGGGCTCCCTGGGG - Intergenic
1060794495 9:126504798-126504820 CCCCCACCAGGGGCATCCTCGGG - Exonic
1061191475 9:129085129-129085151 CCCCAACCTGGGGGAACCTCAGG - Intronic
1061191536 9:129085379-129085401 CCCACCCCAGGGGCATCCAAAGG - Intronic
1061403665 9:130382194-130382216 CCCGCACCAGGGGGATCTGCAGG - Intronic
1062161002 9:135079805-135079827 ACCCCACCAGGGGCATCCAGGGG - Intronic
1203521559 Un_GL000213v1:51572-51594 GTCCCACCAGGGGCCTCCACTGG - Intergenic
1203697212 Un_GL000214v1:109573-109595 GCCCCACCAGGGTGACCCTCAGG - Intergenic
1203552004 Un_KI270743v1:171456-171478 GCCCCACCAGGGTGACCCTCAGG + Intergenic
1185850484 X:3481323-3481345 TCCCAACCAGTGGCATCCTAAGG + Intergenic
1190214193 X:48469121-48469143 CCCCCACCACCAGCACCCTCCGG + Intronic
1190719141 X:53132766-53132788 CCATCACCAGGGGCATACACAGG + Intergenic
1190745069 X:53317653-53317675 CCTCCACCAGGGGGAGCCTGGGG + Intronic
1196314764 X:114209968-114209990 CCCCCACCAAATGGATCCTCTGG + Intergenic
1199718512 X:150525080-150525102 CCCCACCCAGGGACAACCTCTGG - Intergenic
1200068301 X:153515456-153515478 CCCCCAGCAGGAGCATCCCTTGG - Intergenic
1200212820 X:154354459-154354481 CACCCACCAGGGGCCTCTCCGGG + Exonic