ID: 1060796566

View in Genome Browser
Species Human (GRCh38)
Location 9:126516088-126516110
Sequence CCCTCCCACCAGGAGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060796566_1060796572 -2 Left 1060796566 9:126516088-126516110 CCTCAGAACTCCTGGTGGGAGGG No data
Right 1060796572 9:126516109-126516131 GGCAGAGTACCCCCAGGCTGGGG No data
1060796566_1060796570 -4 Left 1060796566 9:126516088-126516110 CCTCAGAACTCCTGGTGGGAGGG No data
Right 1060796570 9:126516107-126516129 AGGGCAGAGTACCCCCAGGCTGG No data
1060796566_1060796571 -3 Left 1060796566 9:126516088-126516110 CCTCAGAACTCCTGGTGGGAGGG No data
Right 1060796571 9:126516108-126516130 GGGCAGAGTACCCCCAGGCTGGG No data
1060796566_1060796569 -8 Left 1060796566 9:126516088-126516110 CCTCAGAACTCCTGGTGGGAGGG No data
Right 1060796569 9:126516103-126516125 TGGGAGGGCAGAGTACCCCCAGG No data
1060796566_1060796577 9 Left 1060796566 9:126516088-126516110 CCTCAGAACTCCTGGTGGGAGGG No data
Right 1060796577 9:126516120-126516142 CCCAGGCTGGGGCCTTCCAAGGG No data
1060796566_1060796575 8 Left 1060796566 9:126516088-126516110 CCTCAGAACTCCTGGTGGGAGGG No data
Right 1060796575 9:126516119-126516141 CCCCAGGCTGGGGCCTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060796566 Original CRISPR CCCTCCCACCAGGAGTTCTG AGG (reversed) Intergenic
No off target data available for this crispr