ID: 1060801375

View in Genome Browser
Species Human (GRCh38)
Location 9:126547791-126547813
Sequence CTCTGGGTGGGGAGGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060801375_1060801386 3 Left 1060801375 9:126547791-126547813 CCCTCATCCCTCCCCACCCAGAG No data
Right 1060801386 9:126547817-126547839 GCCTGCTCCCCTCACCAAGGTGG No data
1060801375_1060801385 0 Left 1060801375 9:126547791-126547813 CCCTCATCCCTCCCCACCCAGAG No data
Right 1060801385 9:126547814-126547836 CCAGCCTGCTCCCCTCACCAAGG No data
1060801375_1060801389 9 Left 1060801375 9:126547791-126547813 CCCTCATCCCTCCCCACCCAGAG No data
Right 1060801389 9:126547823-126547845 TCCCCTCACCAAGGTGGCCAGGG No data
1060801375_1060801388 8 Left 1060801375 9:126547791-126547813 CCCTCATCCCTCCCCACCCAGAG No data
Right 1060801388 9:126547822-126547844 CTCCCCTCACCAAGGTGGCCAGG No data
1060801375_1060801394 17 Left 1060801375 9:126547791-126547813 CCCTCATCCCTCCCCACCCAGAG No data
Right 1060801394 9:126547831-126547853 CCAAGGTGGCCAGGGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060801375 Original CRISPR CTCTGGGTGGGGAGGGATGA GGG (reversed) Intergenic
No off target data available for this crispr