ID: 1060803091

View in Genome Browser
Species Human (GRCh38)
Location 9:126556994-126557016
Sequence GGCCAGCAGAGCGCACACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060803091_1060803099 22 Left 1060803091 9:126556994-126557016 CCCATGTGTGCGCTCTGCTGGCC No data
Right 1060803099 9:126557039-126557061 ATGACTCCCTAATCCTCACTTGG No data
1060803091_1060803102 30 Left 1060803091 9:126556994-126557016 CCCATGTGTGCGCTCTGCTGGCC No data
Right 1060803102 9:126557047-126557069 CTAATCCTCACTTGGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060803091 Original CRISPR GGCCAGCAGAGCGCACACAT GGG (reversed) Intergenic
No off target data available for this crispr