ID: 1060804195

View in Genome Browser
Species Human (GRCh38)
Location 9:126564463-126564485
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060804195_1060804207 19 Left 1060804195 9:126564463-126564485 CCTGTCACCAGCCACTGTCCAGC No data
Right 1060804207 9:126564505-126564527 CCCTGTGCCCTGACCCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060804195 Original CRISPR GCTGGACAGTGGCTGGTGAC AGG (reversed) Intergenic
No off target data available for this crispr