ID: 1060804207

View in Genome Browser
Species Human (GRCh38)
Location 9:126564505-126564527
Sequence CCCTGTGCCCTGACCCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060804198_1060804207 1 Left 1060804198 9:126564481-126564503 CCAGCCATGTCCCCAGCCACAGC No data
Right 1060804207 9:126564505-126564527 CCCTGTGCCCTGACCCTGTCTGG No data
1060804197_1060804207 8 Left 1060804197 9:126564474-126564496 CCACTGTCCAGCCATGTCCCCAG No data
Right 1060804207 9:126564505-126564527 CCCTGTGCCCTGACCCTGTCTGG No data
1060804195_1060804207 19 Left 1060804195 9:126564463-126564485 CCTGTCACCAGCCACTGTCCAGC No data
Right 1060804207 9:126564505-126564527 CCCTGTGCCCTGACCCTGTCTGG No data
1060804200_1060804207 -9 Left 1060804200 9:126564491-126564513 CCCCAGCCACAGCCCCCTGTGCC No data
Right 1060804207 9:126564505-126564527 CCCTGTGCCCTGACCCTGTCTGG No data
1060804201_1060804207 -10 Left 1060804201 9:126564492-126564514 CCCAGCCACAGCCCCCTGTGCCC No data
Right 1060804207 9:126564505-126564527 CCCTGTGCCCTGACCCTGTCTGG No data
1060804196_1060804207 12 Left 1060804196 9:126564470-126564492 CCAGCCACTGTCCAGCCATGTCC No data
Right 1060804207 9:126564505-126564527 CCCTGTGCCCTGACCCTGTCTGG No data
1060804199_1060804207 -3 Left 1060804199 9:126564485-126564507 CCATGTCCCCAGCCACAGCCCCC No data
Right 1060804207 9:126564505-126564527 CCCTGTGCCCTGACCCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060804207 Original CRISPR CCCTGTGCCCTGACCCTGTC TGG Intergenic
No off target data available for this crispr