ID: 1060806801

View in Genome Browser
Species Human (GRCh38)
Location 9:126582823-126582845
Sequence CTTCCCAAGGATGAGGTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060806801_1060806808 19 Left 1060806801 9:126582823-126582845 CCACAAACCTCATCCTTGGGAAG No data
Right 1060806808 9:126582865-126582887 GGAGTGAACCTGTGGAGTGCAGG No data
1060806801_1060806805 -6 Left 1060806801 9:126582823-126582845 CCACAAACCTCATCCTTGGGAAG No data
Right 1060806805 9:126582840-126582862 GGGAAGCAGATGGTGTTTAGAGG No data
1060806801_1060806806 -2 Left 1060806801 9:126582823-126582845 CCACAAACCTCATCCTTGGGAAG No data
Right 1060806806 9:126582844-126582866 AGCAGATGGTGTTTAGAGGACGG No data
1060806801_1060806807 11 Left 1060806801 9:126582823-126582845 CCACAAACCTCATCCTTGGGAAG No data
Right 1060806807 9:126582857-126582879 TAGAGGACGGAGTGAACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060806801 Original CRISPR CTTCCCAAGGATGAGGTTTG TGG (reversed) Intergenic
No off target data available for this crispr