ID: 1060811374

View in Genome Browser
Species Human (GRCh38)
Location 9:126613072-126613094
Sequence ACTGCTCCTGCCCCTGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060811369_1060811374 -10 Left 1060811369 9:126613059-126613081 CCGGGTCTTGCCCACTGCTCCTG No data
Right 1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG No data
1060811358_1060811374 22 Left 1060811358 9:126613027-126613049 CCTAGCGCCCCTCACTGCAAACC No data
Right 1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG No data
1060811368_1060811374 -9 Left 1060811368 9:126613058-126613080 CCCGGGTCTTGCCCACTGCTCCT No data
Right 1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG No data
1060811357_1060811374 25 Left 1060811357 9:126613024-126613046 CCTCCTAGCGCCCCTCACTGCAA No data
Right 1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG No data
1060811367_1060811374 0 Left 1060811367 9:126613049-126613071 CCTAGGAGGCCCGGGTCTTGCCC No data
Right 1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG No data
1060811360_1060811374 15 Left 1060811360 9:126613034-126613056 CCCCTCACTGCAAACCCTAGGAG No data
Right 1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG No data
1060811366_1060811374 1 Left 1060811366 9:126613048-126613070 CCCTAGGAGGCCCGGGTCTTGCC No data
Right 1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG No data
1060811363_1060811374 13 Left 1060811363 9:126613036-126613058 CCTCACTGCAAACCCTAGGAGGC No data
Right 1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG No data
1060811361_1060811374 14 Left 1060811361 9:126613035-126613057 CCCTCACTGCAAACCCTAGGAGG No data
Right 1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG No data
1060811356_1060811374 26 Left 1060811356 9:126613023-126613045 CCCTCCTAGCGCCCCTCACTGCA No data
Right 1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060811374 Original CRISPR ACTGCTCCTGCCCCTGCCCG GGG Intergenic
No off target data available for this crispr