ID: 1060811703

View in Genome Browser
Species Human (GRCh38)
Location 9:126614150-126614172
Sequence TCTGCAGCAGCCGCCGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060811699_1060811703 -10 Left 1060811699 9:126614137-126614159 CCCCGCGGCTCCGTCTGCAGCAG No data
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data
1060811691_1060811703 11 Left 1060811691 9:126614116-126614138 CCACCGCCGCCGCCGCCTCCTCC 0: 24
1: 183
2: 1734
3: 3107
4: 9179
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data
1060811689_1060811703 17 Left 1060811689 9:126614110-126614132 CCACCGCCACCGCCGCCGCCGCC 0: 41
1: 1155
2: 1734
3: 3229
4: 6380
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data
1060811693_1060811703 5 Left 1060811693 9:126614122-126614144 CCGCCGCCGCCTCCTCCCCGCGG No data
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data
1060811686_1060811703 26 Left 1060811686 9:126614101-126614123 CCGCCGCCGCCACCGCCACCGCC 0: 15
1: 161
2: 1466
3: 2720
4: 8313
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data
1060811685_1060811703 30 Left 1060811685 9:126614097-126614119 CCTGCCGCCGCCGCCACCGCCAC No data
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data
1060811695_1060811703 2 Left 1060811695 9:126614125-126614147 CCGCCGCCTCCTCCCCGCGGCTC No data
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data
1060811698_1060811703 -7 Left 1060811698 9:126614134-126614156 CCTCCCCGCGGCTCCGTCTGCAG No data
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data
1060811692_1060811703 8 Left 1060811692 9:126614119-126614141 CCGCCGCCGCCGCCTCCTCCCCG No data
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data
1060811696_1060811703 -1 Left 1060811696 9:126614128-126614150 CCGCCTCCTCCCCGCGGCTCCGT No data
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data
1060811690_1060811703 14 Left 1060811690 9:126614113-126614135 CCGCCACCGCCGCCGCCGCCTCC No data
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data
1060811687_1060811703 23 Left 1060811687 9:126614104-126614126 CCGCCGCCACCGCCACCGCCGCC 0: 13
1: 138
2: 1422
3: 2629
4: 8312
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data
1060811697_1060811703 -4 Left 1060811697 9:126614131-126614153 CCTCCTCCCCGCGGCTCCGTCTG No data
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data
1060811688_1060811703 20 Left 1060811688 9:126614107-126614129 CCGCCACCGCCACCGCCGCCGCC 0: 11
1: 147
2: 1448
3: 2723
4: 8166
Right 1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060811703 Original CRISPR TCTGCAGCAGCCGCCGCCGC CGG Intergenic
No off target data available for this crispr