ID: 1060813465

View in Genome Browser
Species Human (GRCh38)
Location 9:126622934-126622956
Sequence GGTAGTAATTCCAATCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060813464_1060813465 -5 Left 1060813464 9:126622916-126622938 CCTTCTCTGTGAAAAGGGGGTAG 0: 1
1: 0
2: 5
3: 43
4: 423
Right 1060813465 9:126622934-126622956 GGTAGTAATTCCAATCTTACAGG No data
1060813463_1060813465 -4 Left 1060813463 9:126622915-126622937 CCCTTCTCTGTGAAAAGGGGGTA 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1060813465 9:126622934-126622956 GGTAGTAATTCCAATCTTACAGG No data
1060813457_1060813465 10 Left 1060813457 9:126622901-126622923 CCTGAGCCTCAGTTCCCTTCTCT 0: 1
1: 6
2: 95
3: 527
4: 2054
Right 1060813465 9:126622934-126622956 GGTAGTAATTCCAATCTTACAGG No data
1060813458_1060813465 4 Left 1060813458 9:126622907-126622929 CCTCAGTTCCCTTCTCTGTGAAA 0: 1
1: 18
2: 176
3: 1420
4: 5717
Right 1060813465 9:126622934-126622956 GGTAGTAATTCCAATCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060813465 Original CRISPR GGTAGTAATTCCAATCTTAC AGG Intronic
No off target data available for this crispr