ID: 1060814071

View in Genome Browser
Species Human (GRCh38)
Location 9:126625708-126625730
Sequence GACGAGGGTGGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2852
Summary {0: 1, 1: 1, 2: 23, 3: 278, 4: 2549}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060814071_1060814078 -8 Left 1060814071 9:126625708-126625730 CCGCCGCCGCCGCCACCCTCGTC 0: 1
1: 1
2: 23
3: 278
4: 2549
Right 1060814078 9:126625723-126625745 CCCTCGTCCCACCGTTTGCAGGG No data
1060814071_1060814084 11 Left 1060814071 9:126625708-126625730 CCGCCGCCGCCGCCACCCTCGTC 0: 1
1: 1
2: 23
3: 278
4: 2549
Right 1060814084 9:126625742-126625764 AGGGCTTTCCTGCGGCGCTCTGG No data
1060814071_1060814083 3 Left 1060814071 9:126625708-126625730 CCGCCGCCGCCGCCACCCTCGTC 0: 1
1: 1
2: 23
3: 278
4: 2549
Right 1060814083 9:126625734-126625756 CCGTTTGCAGGGCTTTCCTGCGG No data
1060814071_1060814076 -9 Left 1060814071 9:126625708-126625730 CCGCCGCCGCCGCCACCCTCGTC 0: 1
1: 1
2: 23
3: 278
4: 2549
Right 1060814076 9:126625722-126625744 ACCCTCGTCCCACCGTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060814071 Original CRISPR GACGAGGGTGGCGGCGGCGG CGG (reversed) Intronic
Too many off-targets to display for this crispr