ID: 1060815908

View in Genome Browser
Species Human (GRCh38)
Location 9:126635043-126635065
Sequence CTTCATATGGCGCTTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060815908_1060815914 1 Left 1060815908 9:126635043-126635065 CCAGGCACAAGCGCCATATGAAG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1060815914 9:126635067-126635089 CTGCTGATGGCCTGGGAGACAGG No data
1060815908_1060815912 -6 Left 1060815908 9:126635043-126635065 CCAGGCACAAGCGCCATATGAAG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1060815912 9:126635060-126635082 ATGAAGCCTGCTGATGGCCTGGG No data
1060815908_1060815911 -7 Left 1060815908 9:126635043-126635065 CCAGGCACAAGCGCCATATGAAG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1060815911 9:126635059-126635081 TATGAAGCCTGCTGATGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060815908 Original CRISPR CTTCATATGGCGCTTGTGCC TGG (reversed) Intronic
902505938 1:16939114-16939136 CTGCAGCTGGCGCTTGTGCAGGG - Exonic
908333480 1:63096070-63096092 CTGCAGATGACGCTTGTACCTGG - Intergenic
913411134 1:118553034-118553056 CTTCTTATGGCGATTGTGAATGG - Intergenic
915012176 1:152698084-152698106 ATTCTTAAGGAGCTTGTGCCTGG - Intergenic
922456122 1:225775014-225775036 CTTGATTTGGCCCTTCTGCCAGG + Intergenic
923483316 1:234404972-234404994 CTTCATATGGGGCTGGGGCGAGG - Intronic
1074970714 10:118534279-118534301 GCTCATATGGGCCTTGTGCCTGG - Intergenic
1083882233 11:65554288-65554310 CTTCACTGGGCGCTTCTGCCAGG - Exonic
1090666572 11:128918589-128918611 CTGGATATGGCGCTTCTTCCTGG + Exonic
1092492355 12:8956865-8956887 CTTCACATGAAGCTGGTGCCTGG + Intronic
1095806950 12:46330185-46330207 CTGCATATGGCCTTTGTGACTGG - Intergenic
1122467049 14:101940925-101940947 CTTCTTATGGACCTTGTGTCAGG - Intergenic
1129596252 15:76966758-76966780 CTGCATATGCCTCTTGTTCCTGG - Intergenic
1129597216 15:76974409-76974431 CTACATATGGCCCTGATGCCAGG - Intergenic
1143043403 17:4056645-4056667 CTTTATTTGGCCCTAGTGCCTGG - Intronic
1146957560 17:36945243-36945265 CTTAATATGTATCTTGTGCCAGG - Intergenic
1152560417 17:81075835-81075857 CCTCATATGGAGCCTGTGGCTGG - Intronic
1153988552 18:10374830-10374852 ATTCAGATGGCGCTGGTGGCAGG + Intergenic
1160463825 18:79059224-79059246 CTCCATATGGCGGTTGGGCCGGG + Intergenic
925879094 2:8335934-8335956 CTTCACCTGGCGCCTGTGGCTGG - Intergenic
939928312 2:148201274-148201296 CTCCACATGGGGCTTGTTCCTGG + Intronic
942396565 2:175556091-175556113 ATTCATTAGGCACTTGTGCCAGG - Intergenic
942952161 2:181732994-181733016 CGTAATATAGTGCTTGTGCCAGG - Intergenic
943657807 2:190528054-190528076 CTTCTTTTGGCTCTTGTGCATGG - Intronic
948511238 2:238466611-238466633 CTTCAGATGCTGCTTCTGCCAGG + Intergenic
1174128033 20:48322271-48322293 CTTCATATAGCACTTCTTCCTGG + Intergenic
953230812 3:41063339-41063361 CTTCAAATGGGGCTTGTCCCTGG - Intergenic
953556557 3:43950792-43950814 CTTCTTATGGCTCTTATGGCTGG - Intergenic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
969042777 4:4313776-4313798 CATCATCTGGTGGTTGTGCCAGG + Intronic
975656117 4:76642733-76642755 CTTCATAGAGCCCTTGTTCCTGG - Intronic
978906519 4:114012327-114012349 CTTCAGATGGGGTTTTTGCCTGG + Intergenic
983472532 4:168174381-168174403 CTCCATGTGGGGCTTGTGGCTGG - Intronic
990187526 5:53224027-53224049 CATCAGATGGCGCTTGCCCCAGG + Intergenic
1002004264 5:176219202-176219224 CGTCATATGGCACCTGTTCCTGG - Intergenic
1002222109 5:177691427-177691449 CGTCATATGGCACCTGTTCCTGG + Intergenic
1005417863 6:25620759-25620781 CTTCATATGACCCTTATGCATGG - Intergenic
1010862358 6:80928213-80928235 CTTCATATGGGAATTGTGCTGGG - Intergenic
1013453111 6:110304140-110304162 CTTCAGATGGAGTTTTTGCCCGG - Intronic
1018416483 6:163606372-163606394 CTCCATATGGTGCTGGGGCCAGG - Intergenic
1021895403 7:25230311-25230333 ATTAATATGGGGCTTGGGCCAGG + Intergenic
1040122366 8:43697308-43697330 CTTCATGTGGCAGTTGTACCTGG + Intergenic
1049575934 8:143389622-143389644 CTTCATAATGCGCTGGTTCCAGG + Intergenic
1050825461 9:9939982-9940004 CTGAATATGGATCTTGTGCCAGG + Intronic
1051711279 9:19933860-19933882 CTACATGTGGCTTTTGTGCCTGG - Intergenic
1052916286 9:33926452-33926474 TTTCATCTGGCGGTTGTGCCAGG - Intronic
1058695996 9:107559441-107559463 CTTCACATGGATCTTGTGCTAGG - Intergenic
1060815908 9:126635043-126635065 CTTCATATGGCGCTTGTGCCTGG - Intronic
1192713376 X:73615511-73615533 CTTCAAATGGTGCTTGTGATTGG + Intronic
1200141688 X:153905734-153905756 CTTCATTGGCCACTTGTGCCTGG + Exonic