ID: 1060816517

View in Genome Browser
Species Human (GRCh38)
Location 9:126638159-126638181
Sequence GAGAGGGGCTCACCTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 656}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060816517_1060816527 0 Left 1060816517 9:126638159-126638181 CCTGGCCCAGGTGAGCCCCTCTC 0: 1
1: 0
2: 3
3: 72
4: 656
Right 1060816527 9:126638182-126638204 TGCTGGTGTCCCTGGCAGGTGGG No data
1060816517_1060816536 25 Left 1060816517 9:126638159-126638181 CCTGGCCCAGGTGAGCCCCTCTC 0: 1
1: 0
2: 3
3: 72
4: 656
Right 1060816536 9:126638207-126638229 CCGACAGGAATGCTCCGGTGGGG No data
1060816517_1060816526 -1 Left 1060816517 9:126638159-126638181 CCTGGCCCAGGTGAGCCCCTCTC 0: 1
1: 0
2: 3
3: 72
4: 656
Right 1060816526 9:126638181-126638203 CTGCTGGTGTCCCTGGCAGGTGG No data
1060816517_1060816525 -4 Left 1060816517 9:126638159-126638181 CCTGGCCCAGGTGAGCCCCTCTC 0: 1
1: 0
2: 3
3: 72
4: 656
Right 1060816525 9:126638178-126638200 TCTCTGCTGGTGTCCCTGGCAGG No data
1060816517_1060816531 20 Left 1060816517 9:126638159-126638181 CCTGGCCCAGGTGAGCCCCTCTC 0: 1
1: 0
2: 3
3: 72
4: 656
Right 1060816531 9:126638202-126638224 GGGTCCCGACAGGAATGCTCCGG No data
1060816517_1060816530 10 Left 1060816517 9:126638159-126638181 CCTGGCCCAGGTGAGCCCCTCTC 0: 1
1: 0
2: 3
3: 72
4: 656
Right 1060816530 9:126638192-126638214 CCTGGCAGGTGGGTCCCGACAGG No data
1060816517_1060816537 26 Left 1060816517 9:126638159-126638181 CCTGGCCCAGGTGAGCCCCTCTC 0: 1
1: 0
2: 3
3: 72
4: 656
Right 1060816537 9:126638208-126638230 CGACAGGAATGCTCCGGTGGGGG No data
1060816517_1060816532 23 Left 1060816517 9:126638159-126638181 CCTGGCCCAGGTGAGCCCCTCTC 0: 1
1: 0
2: 3
3: 72
4: 656
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816517_1060816522 -8 Left 1060816517 9:126638159-126638181 CCTGGCCCAGGTGAGCCCCTCTC 0: 1
1: 0
2: 3
3: 72
4: 656
Right 1060816522 9:126638174-126638196 CCCCTCTCTGCTGGTGTCCCTGG No data
1060816517_1060816534 24 Left 1060816517 9:126638159-126638181 CCTGGCCCAGGTGAGCCCCTCTC 0: 1
1: 0
2: 3
3: 72
4: 656
Right 1060816534 9:126638206-126638228 CCCGACAGGAATGCTCCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060816517 Original CRISPR GAGAGGGGCTCACCTGGGCC AGG (reversed) Intronic
900183057 1:1320826-1320848 TGCAGGGGCTCACCTCGGCCAGG + Intronic
900249271 1:1658812-1658834 GAGCGGGGCGGACCCGGGCCCGG - Intronic
900260219 1:1724156-1724178 GAGCGGGGCGGACCCGGGCCCGG - Intronic
900289721 1:1918828-1918850 GGGCGGGGGTCACCGGGGCCAGG - Intronic
900446916 1:2685835-2685857 GTCAGAGGCTCACCTGGGCATGG - Intronic
900448417 1:2693302-2693324 GTCAGAGGCTCACCTGGGCATGG - Intronic
900451122 1:2750320-2750342 GTCAGAGGCTCACCTGGGCATGG - Intronic
900451354 1:2751483-2751505 GTCAGAGGCTCACCTGGGCATGG - Intronic
900451890 1:2754254-2754276 GTCAGAGGCTCACCTGGGCATGG - Intronic
900551104 1:3256022-3256044 GACAGCGCCTCACCTGGGACTGG + Intronic
900565468 1:3329774-3329796 GAGAGGGGCACGCCTGGGAGAGG + Intronic
900613960 1:3556044-3556066 GAGAGGGGCTCCCCTGGCCACGG - Intronic
900649173 1:3722655-3722677 GAGAGGCGCCCAGCTGTGCCAGG - Intronic
900983467 1:6059668-6059690 GAGAGGTGCTCGCTTGGGGCTGG + Intronic
901299223 1:8186887-8186909 GGGAGAGGATCACCTGAGCCAGG + Intergenic
901451292 1:9338295-9338317 GACAGGGTCTCCCCTGGGCAGGG - Intronic
901691618 1:10977063-10977085 GTGGGAGGATCACCTGGGCCCGG + Intronic
902250698 1:15153021-15153043 GAATGGGCCCCACCTGGGCCGGG + Intronic
903286430 1:22279815-22279837 GTGAGAGGATCACCTGAGCCTGG + Intergenic
903544804 1:24117276-24117298 GTGAGAGGATCACCTGAGCCAGG + Intergenic
903646010 1:24896917-24896939 GAAAGGGCCTGCCCTGGGCCTGG - Intergenic
903664115 1:24996221-24996243 GAGAAGGGCCAGCCTGGGCCAGG - Intergenic
903714525 1:25354516-25354538 GTGAGAGGATCACCTGAGCCCGG + Intronic
903963025 1:27069118-27069140 GAGGGAGGCTCACTTGAGCCTGG + Intergenic
904095950 1:27977553-27977575 AAGAAGGGGTGACCTGGGCCAGG + Intronic
904130867 1:28274149-28274171 GAGAGAGCCCTACCTGGGCCCGG - Exonic
904228452 1:29045445-29045467 GTGGGAGGATCACCTGGGCCTGG - Intronic
906038492 1:42767543-42767565 GGTAGGGGCTCACCAGGGCCAGG - Exonic
906111740 1:43328307-43328329 GTGAGTGGATCACCTGAGCCTGG + Intergenic
906308382 1:44735888-44735910 GTGGGAGGATCACCTGGGCCTGG - Intergenic
906696933 1:47829322-47829344 GAGAGGGGCTCAGTTAGGGCAGG + Intronic
907059635 1:51408719-51408741 GTGAGAGGATCACCTGAGCCTGG - Intronic
907182208 1:52580726-52580748 GCGAGAGGCTCACTTGAGCCAGG - Intergenic
907962784 1:59298342-59298364 CAGAGGGGGTCAGCTGGGCCTGG + Intronic
908166776 1:61466871-61466893 GAGATGGCCTCACCTGGCTCTGG - Intergenic
908166953 1:61468284-61468306 GAGATGGCCTCACCTGGCTCTGG + Intergenic
910173572 1:84403878-84403900 GTGGGAGGGTCACCTGGGCCTGG - Intronic
910553032 1:88498227-88498249 GAGAGGAGCTCACCAGGGAAAGG + Intergenic
910877931 1:91895058-91895080 GAGAGTGTCTCAGCTGGGCGCGG - Intronic
910910193 1:92225197-92225219 GAGGGAGGATCACCTGAGCCTGG - Intronic
912451388 1:109769783-109769805 GAGGGGTGGACACCTGGGCCAGG + Intronic
912492991 1:110072175-110072197 GAGATGGGAGCACCTGGGGCTGG + Intronic
913184437 1:116356163-116356185 GTGGGAGGATCACCTGGGCCTGG + Intergenic
913257083 1:116963429-116963451 GAGAGGGGCTGGCCTCTGCCAGG - Intronic
914690313 1:150020032-150020054 GAGAGAGGATCACTTGAGCCAGG + Intergenic
914768622 1:150662993-150663015 GAGAGGGACTCATATGGGTCAGG - Intronic
915410705 1:155699705-155699727 GTGGGAGGATCACCTGGGCCTGG - Intronic
915901135 1:159847356-159847378 CAGGGTGGCCCACCTGGGCCAGG - Intronic
916893692 1:169138623-169138645 GTGAGGGGATCACTTGAGCCTGG + Intronic
917600118 1:176565599-176565621 GTGGGGGGATCACCTGAGCCTGG + Intronic
918364728 1:183795609-183795631 GGCAGGGGCTAACCTGGGCAAGG + Intronic
919701411 1:200635311-200635333 GTGAGAGGATCACCTGAGCCTGG - Intronic
920431431 1:205921553-205921575 CCGAGGGCCTCACCTTGGCCAGG + Exonic
920743634 1:208604918-208604940 AAGATGGGCTCAGCTGGCCCTGG + Intergenic
921205732 1:212846983-212847005 GTGGGGGGATCACCTGAGCCCGG - Intronic
921271493 1:213474236-213474258 GAGCTGGGCTCTCCTTGGCCCGG + Intergenic
922442177 1:225664969-225664991 TAGATGAGCTCACCTGGGGCTGG - Intergenic
923503117 1:234582749-234582771 GAGAGGGGCCCGCCTGGGCCTGG - Intergenic
923649935 1:235864833-235864855 GTGAGAGGATCACCTGAGCCTGG + Intronic
924136536 1:240972953-240972975 GCGGGAGGATCACCTGGGCCTGG + Intronic
924335753 1:242985551-242985573 GAGAGAGGATCACTTGAGCCTGG + Intergenic
1063123439 10:3120751-3120773 GTGAGAGGATCACCTGAGCCCGG - Intronic
1063353521 10:5377155-5377177 GTGAGAGGATCACTTGGGCCTGG - Intergenic
1063424571 10:5941378-5941400 GTGGGAGGGTCACCTGGGCCTGG - Intronic
1064582436 10:16808107-16808129 CCGAAGGGCTCACCAGGGCCAGG - Intronic
1065352007 10:24804156-24804178 GAAAGGGGCTTTCCTGGGCGGGG - Intergenic
1065445255 10:25791727-25791749 GGGAGGGGATCACTTGAGCCAGG + Intergenic
1065707078 10:28480223-28480245 GTGGGAGGATCACCTGGGCCCGG - Intergenic
1065816022 10:29483272-29483294 GAGGGGGACAAACCTGGGCCAGG + Intronic
1066063359 10:31744047-31744069 GTGGGAGGATCACCTGGGCCTGG - Intergenic
1066129956 10:32383443-32383465 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1066244675 10:33571101-33571123 GTGAGAGGATCACTTGGGCCTGG - Intergenic
1067061852 10:43081753-43081775 CAGAGGGGCTCTGGTGGGCCTGG - Intronic
1067375874 10:45727338-45727360 GAGAGGGGCCGGCCTGGGCTGGG + Intronic
1067481270 10:46599665-46599687 GCGAGAGGCTCACCTAAGCCTGG + Intergenic
1067613481 10:47742066-47742088 GCGAGAGGCTCACCTAAGCCTGG - Intergenic
1067655782 10:48190238-48190260 AAGAGGGCCACACCTGAGCCAGG - Intronic
1067701433 10:48575919-48575941 GATAGGGGCTGACCAGGACCAGG - Intronic
1069832900 10:71291812-71291834 GGCAGGGGCTCACCTGTGCCGGG - Exonic
1069918331 10:71800758-71800780 GAGGGGTGCCAACCTGGGCCAGG + Intronic
1070313854 10:75293273-75293295 GTGAGAGGCTCATCTGGGCCAGG + Intergenic
1070327054 10:75396210-75396232 GAGAGAGGCTGAGCTGGGCCTGG - Intergenic
1070680872 10:78448199-78448221 CATAGGGGCTCACATGGGTCAGG + Intergenic
1070890833 10:79941361-79941383 CAGCGGGGCTTCCCTGGGCCAGG + Intronic
1072352208 10:94567812-94567834 GTGAGAGGATCACCTGAGCCTGG + Intronic
1072646880 10:97263017-97263039 GTGGGAGGCTCACCTGAGCCCGG + Intronic
1072679848 10:97498811-97498833 GAGAGGGGCCGGCCTGGGGCGGG + Intergenic
1072913313 10:99522182-99522204 GAGGGGACCTCACCTGCGCCTGG - Intergenic
1072975366 10:100052784-100052806 GAGGGAGGCTCACCTGAGCCTGG + Intronic
1073012887 10:100374912-100374934 GTGGGGGGATCACCTGAGCCTGG + Intergenic
1073098085 10:100992503-100992525 GACAGGGTCTCAGCTGGGCACGG - Intronic
1073196229 10:101694469-101694491 GCCAGCGGCACACCTGGGCCAGG + Exonic
1074850953 10:117439257-117439279 GAGAGGGGCCCAGCTGAGCCTGG + Intergenic
1075222085 10:120593724-120593746 GAGATTGGCTCACCTAGGCTGGG - Intergenic
1075442928 10:122493941-122493963 GAGAGGGGCGCTCCTGGGAGGGG - Intronic
1075829471 10:125393869-125393891 GAGGGAGGATCACCTGAGCCTGG - Intergenic
1075851342 10:125590342-125590364 GTGGGAGGATCACCTGGGCCAGG - Intronic
1076313737 10:129526405-129526427 GAGATTGGCTCACCTGGGGGAGG - Intronic
1076410410 10:130245068-130245090 GAGTGTGGCTCACCTGGGCCTGG + Intergenic
1076467956 10:130697916-130697938 GAGAGGGAGTCACCAGGACCTGG + Intergenic
1076508060 10:130991696-130991718 AAGAGAGGATCACCTGAGCCAGG - Intergenic
1076577538 10:131479783-131479805 GTGAGAGGGTCACCTGAGCCTGG - Intergenic
1076698886 10:132260106-132260128 GAGAGAGGGTCACCTGGCTCAGG + Intronic
1076734177 10:132451388-132451410 GAGAGGGGCTGACATAGACCTGG - Intergenic
1076848927 10:133083556-133083578 GGGAGGGGCTCACCCTGGCGAGG + Intronic
1076898793 10:133327006-133327028 GAGAGGGGCTCAGCCACGCCAGG + Intronic
1077057684 11:603147-603169 GTGGGAGGATCACCTGGGCCTGG - Intronic
1077078193 11:710633-710655 GCGAGGGGGTCACTTGAGCCCGG + Intronic
1077192215 11:1260262-1260284 GGGAGGGGCCCACCCGGGCAGGG - Intronic
1077370732 11:2180497-2180519 CAGAGGGTCTCACTGGGGCCAGG - Intergenic
1077385077 11:2265479-2265501 GACAGAGCCTCACCTGGCCCAGG - Intergenic
1077434793 11:2533768-2533790 GCCAGGCCCTCACCTGGGCCAGG - Intronic
1077635964 11:3841279-3841301 GAGAAAGGCGCCCCTGGGCCTGG + Intergenic
1081174434 11:39909615-39909637 GTAAGAGGATCACCTGGGCCCGG + Intergenic
1081770656 11:45648819-45648841 GAGAGGGCCTCAGCCGGGTCTGG - Intergenic
1082831057 11:57617636-57617658 GACAGGGTCTCAGCTGGGCACGG + Intergenic
1082960577 11:58915371-58915393 AAGAGGGGCTCACATGGGAAAGG - Intronic
1083406948 11:62464119-62464141 GAGAGAGGATCACTTGGGCCAGG - Intronic
1083739475 11:64701072-64701094 GAGAGGGACTGATCAGGGCCTGG - Intronic
1083824772 11:65193821-65193843 GTGAGAGGATCACCTGAGCCAGG - Intronic
1083986773 11:66220782-66220804 GAGGGGGGCTCACTTGAGCTTGG - Exonic
1084174153 11:67415115-67415137 CAGAGAGGCCCTCCTGGGCCAGG - Intronic
1084271847 11:68033274-68033296 GGCAGGGGCTCACCTGGGCGGGG - Exonic
1084352690 11:68614737-68614759 GAGAGGGGCTCACCCGGGAAAGG - Exonic
1084457675 11:69277840-69277862 GTGGGGGTCTCACCTGGGCTGGG + Intergenic
1084464268 11:69313138-69313160 AAGAGGGGCTCTGCTGGGCCTGG - Intronic
1084592700 11:70099710-70099732 GGCAGGGGCTCAGCTGGACCAGG + Intronic
1084607935 11:70183454-70183476 GAGGGGGGCTCTCCTTGGCTTGG + Intronic
1085035552 11:73297698-73297720 GAGATGGACAGACCTGGGCCTGG + Exonic
1085041958 11:73331747-73331769 TAGAGGTGGTCACCTGGGCTGGG + Intronic
1085516256 11:77113481-77113503 GAGAGTGGCTCACCTAGAGCTGG - Intronic
1085551615 11:77378679-77378701 GAGAAGGGATCACTTGAGCCTGG - Intronic
1087252502 11:95918929-95918951 GTGAGAGGATCACCTGAGCCTGG - Intronic
1087764583 11:102136432-102136454 GTGAGAGGATCACTTGGGCCTGG - Intronic
1088068627 11:105753904-105753926 GAGGGTGGCTCACCTGGGAAGGG - Intronic
1088104943 11:106196153-106196175 GCGAGGGTCTCACCTTGTCCAGG + Intergenic
1088216176 11:107512405-107512427 GCAAGAGGATCACCTGGGCCTGG - Intronic
1089202393 11:116732230-116732252 CAGATTTGCTCACCTGGGCCTGG - Intergenic
1089254873 11:117188931-117188953 GGAAGGGGCTCAGCTGGGGCAGG + Intronic
1089301207 11:117499754-117499776 GAGTGGGGACCACTTGGGCCTGG + Intronic
1089383978 11:118056178-118056200 CTGAGAGGCTCACTTGGGCCAGG + Intergenic
1090350754 11:126106246-126106268 GGGAGGGGATCACTTGAGCCTGG - Intergenic
1090387981 11:126367479-126367501 GAGAGGGGCTGCCTTGTGCCTGG + Intronic
1090974436 11:131669631-131669653 GACAGAGCCTCACCTGAGCCTGG - Intronic
1091261930 11:134241482-134241504 GAGGGAGGCTGATCTGGGCCTGG + Intronic
1091539290 12:1444741-1444763 GTGAGAGGCTCACCTGCCCCCGG - Exonic
1091750768 12:3020149-3020171 TTGAGGGGCTCTTCTGGGCCAGG + Intronic
1091771293 12:3152876-3152898 GAAGGGGGCTCAGCTGGGCGTGG - Intronic
1091998193 12:5011675-5011697 GTGGGAGGGTCACCTGGGCCTGG + Intergenic
1092221177 12:6714971-6714993 GTGAGAGGATCACCTGAGCCTGG + Intergenic
1092288382 12:7143159-7143181 GTGAGGGGTTCACGTGGACCTGG - Exonic
1092535175 12:9380112-9380134 GAGAGGGGCTTCTCTGGGGCTGG + Intergenic
1094027881 12:25978018-25978040 GAGAGGGTCACTCCTTGGCCTGG + Intronic
1094533212 12:31297247-31297269 GTGAGAGGATCACCTGAGCCTGG - Intronic
1094639832 12:32263039-32263061 GAGAGAGGATCACCTGAGCCCGG + Intronic
1096718567 12:53505263-53505285 GTGAGTGGCTCATGTGGGCCGGG + Intronic
1100447837 12:94677585-94677607 GTGGGGGGATCACCTGAGCCTGG + Intergenic
1100845546 12:98654633-98654655 GCGAGGGGATCACTTGGGTCAGG - Intronic
1101606587 12:106251356-106251378 GTGAGAGGATCACTTGGGCCTGG + Intronic
1102272109 12:111545869-111545891 GTGAGAGGATCACCTGAGCCTGG + Intronic
1102419512 12:112792670-112792692 GGGAGGGGGTCACCTGAGACTGG + Intronic
1103506401 12:121444392-121444414 GAGAGGGGCGGGCCTGGGCCTGG - Intronic
1103922156 12:124404616-124404638 GAGAGGGATGCATCTGGGCCAGG + Intronic
1103928263 12:124435622-124435644 GTGAGGGGCTTAGCTGGGGCAGG - Intronic
1104336002 12:127896057-127896079 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1104946070 12:132415406-132415428 GAGGGGGGTACACCTGGGACCGG - Intergenic
1105412969 13:20186740-20186762 GGGAGAGGCTCACGAGGGCCGGG + Intergenic
1106089673 13:26579091-26579113 GTGGGAGGCTCACCTGAGCCCGG - Intronic
1106223457 13:27766861-27766883 GAGATGGGATCACTTGAGCCTGG + Intergenic
1106292185 13:28374319-28374341 GTGAGAGGATCACCTGAGCCCGG + Intronic
1106917737 13:34533055-34533077 CAGGGGGGCTAACCTGGGCTGGG + Intergenic
1107015497 13:35705462-35705484 GATAGAGGCTGACATGGGCCAGG + Intergenic
1107070187 13:36260002-36260024 GAGAGGGACTGAGCTGGGGCAGG - Intronic
1107505524 13:41029473-41029495 GTGAGAGGATCACCTGAGCCTGG - Intronic
1108182637 13:47855882-47855904 GTGGGAGGATCACCTGGGCCTGG - Intergenic
1110167025 13:72455168-72455190 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1110227667 13:73136617-73136639 GAGGTGGGATCACCTGAGCCTGG - Intergenic
1111661704 13:91220405-91220427 GTGGGAGGATCACCTGGGCCTGG + Intergenic
1111693411 13:91592954-91592976 GACAGGGGCACCCCTGGCCCAGG - Intronic
1112778505 13:102871238-102871260 GCGAGGGCCTCCCCTAGGCCTGG + Intronic
1113119357 13:106909788-106909810 CAGAGGGGCTCACCAGGGCTAGG - Intergenic
1113207765 13:107937387-107937409 GAGAATAGCTCATCTGGGCCAGG + Intergenic
1113770720 13:112906779-112906801 TAGAGGTGCTCGCCTGTGCCGGG - Intronic
1113832947 13:113311176-113311198 GAGAGGTGATCACCAGGGGCTGG + Intronic
1113949629 13:114064813-114064835 GAGTGGGGGCCGCCTGGGCCAGG - Intronic
1114513769 14:23284362-23284384 GAGGGATGCTCAACTGGGCCAGG + Intronic
1114585384 14:23807833-23807855 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1115343903 14:32321788-32321810 GTGAGAGGATCACCTGAGCCTGG + Intergenic
1115686567 14:35802773-35802795 GTGAGAGGATCACCTGGGCCTGG - Intronic
1116004959 14:39282799-39282821 GCGAGAGGATCACCTGAGCCAGG - Intronic
1117700669 14:58410163-58410185 GTGAGAGGGTCACCTGAGCCCGG - Intronic
1117702386 14:58426862-58426884 GAGATGGTGTCACCTGGGCGAGG - Intronic
1118213923 14:63790236-63790258 GTGGGGGGATCACCTGAGCCTGG + Intergenic
1118871683 14:69748333-69748355 GTGGGAGGCTCACCTGAGCCTGG - Intronic
1119472885 14:74910270-74910292 GTGAGGGGCTGAACTAGGCCAGG - Intronic
1121424620 14:93840766-93840788 GCGAGAGGATCACCTGAGCCTGG - Intergenic
1121734254 14:96206734-96206756 GGGAGGGGCCCACCTGGGCGCGG + Intronic
1121794448 14:96723721-96723743 GATAGGGGGTCCCCAGGGCCAGG + Intergenic
1122159597 14:99773737-99773759 GAGCGGCGCCCACCTCGGCCTGG - Intronic
1122457937 14:101869746-101869768 GTGAGAGGATCACCTGAGCCTGG - Intronic
1122660746 14:103293384-103293406 GTGAGAGGATCACCTGGGCCAGG + Intergenic
1122811811 14:104292941-104292963 GAGAGGGGCTCTGCTGGGGAGGG + Intergenic
1122824152 14:104361522-104361544 GTGGTGGGCTCACCAGGGCCTGG + Intergenic
1122969793 14:105147909-105147931 GGGAGCGTCTCACCTGGCCCTGG + Intronic
1123029246 14:105443463-105443485 GTGAGAGGATCACTTGGGCCTGG - Intronic
1123037753 14:105478351-105478373 CAGTGGGGCTCACCTCGGCGTGG - Exonic
1123084318 14:105710594-105710616 GAGCTGGGCTGACCTGGGCTGGG - Intergenic
1123147393 14:106146272-106146294 GTGAGGTGCTCACCTGGTTCTGG - Intergenic
1123627459 15:22237711-22237733 GTAAGGGGCTCAACTGAGCCAGG + Intergenic
1124076770 15:26453795-26453817 TTGTGGGGGTCACCTGGGCCAGG + Intergenic
1124407039 15:29402536-29402558 GCGAGGGGATCACTTGAGCCAGG - Intronic
1124459934 15:29879803-29879825 GTGAGAGGATCACCTGAGCCTGG - Intronic
1124693784 15:31846615-31846637 GATGGGGGCTCACCGGGGGCTGG - Intronic
1124696487 15:31868751-31868773 GTGCGGGTCTCACTTGGGCCTGG - Intronic
1124966623 15:34437101-34437123 GGGAGGGGCTCACCGCGGCGAGG - Intronic
1125716729 15:41823703-41823725 CAGCCGGGCTCACCTGGTCCTGG + Exonic
1126402288 15:48284731-48284753 GTGAGAGGATCACCTGAGCCTGG - Intronic
1126823586 15:52528673-52528695 TGGTGGGGCTCGCCTGGGCCCGG + Intronic
1127115763 15:55725499-55725521 GTGAGAGGATCACCTGAGCCTGG + Intronic
1127986782 15:64078945-64078967 GAGGGAGGCTCACTTGAGCCTGG + Intronic
1128110588 15:65073664-65073686 GAGAGTGGCAGACCTAGGCCTGG - Intronic
1128148595 15:65346993-65347015 GAGAGGGGCTCTGCTGGGTCTGG - Intronic
1128244491 15:66123886-66123908 GAGAGGTACTCACCGGTGCCTGG + Exonic
1128606886 15:69043239-69043261 ATGAGGGGCCCACCTGGACCAGG - Intronic
1128929062 15:71687525-71687547 GCGAGTGGATCACCTGAGCCAGG + Intronic
1128964780 15:72047869-72047891 GTGAGAGGATCACCTGAGCCCGG - Intronic
1129771056 15:78203898-78203920 GAGAGGGGCCCTCCTGGGGCTGG - Intronic
1129794731 15:78367465-78367487 GTGGGAGGATCACCTGGGCCTGG + Intergenic
1130141252 15:81228147-81228169 TAGACGTGCTCACCTGTGCCCGG - Intronic
1130378161 15:83349017-83349039 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1131114611 15:89786597-89786619 GTGGGGGGATCACCTGAGCCTGG + Intronic
1131545174 15:93309785-93309807 GTGAGAGGATCACTTGGGCCTGG + Intergenic
1132335765 15:101047472-101047494 AAGTGGGGCCCAGCTGGGCCTGG + Intronic
1132556206 16:573822-573844 GGGTGGGGCTGAGCTGGGCCTGG + Intronic
1132717413 16:1298747-1298769 AAGAGGGGCTCACCGGGTGCGGG - Intergenic
1132854331 16:2038109-2038131 GATGGGGGCTCACCGGGGCTGGG - Exonic
1132895975 16:2229585-2229607 GTGATGGGCTCCTCTGGGCCTGG - Exonic
1132942538 16:2515075-2515097 GGGAGGGGCTTCCCTGGGCTTGG + Intronic
1133055647 16:3144315-3144337 GGCAGAGGCTCACCTGGACCGGG - Exonic
1133063147 16:3188470-3188492 GAGGAGGGCTCACCTGGGACTGG - Intergenic
1133243557 16:4431228-4431250 GAGAGAGGCTGGACTGGGCCGGG + Intronic
1133510694 16:6454461-6454483 GAGGGAGGATCACCTGAGCCTGG + Intronic
1133807843 16:9138835-9138857 GAGAGGGGCTGACGTGGAGCTGG + Intergenic
1133863663 16:9620850-9620872 GTGGGAGGATCACCTGGGCCTGG + Intergenic
1134108653 16:11501091-11501113 GGGAGGGGCTGACCCGGGTCTGG + Intronic
1134113007 16:11527591-11527613 GACAGGGTCTCAGCTGGGCGCGG + Intergenic
1134164841 16:11921632-11921654 GAGAGGGGATCACCTGAGGTCGG + Intergenic
1134305632 16:13029513-13029535 GAGGGAGGATCACTTGGGCCAGG + Intronic
1134648598 16:15890479-15890501 GAGAGAGGATCACTTGAGCCTGG + Intergenic
1134868971 16:17634344-17634366 GTGAGAGGATCACCTGAGCCTGG + Intergenic
1135264338 16:21009779-21009801 GAGGTGGGATCACCTGGGCCTGG + Intronic
1135484473 16:22852002-22852024 CAGCTGGGCTCACCTGGGCTTGG - Intronic
1135691749 16:24543375-24543397 GTGGGAGGATCACCTGGGCCTGG - Intronic
1136179208 16:28539270-28539292 TCGAGGGCTTCACCTGGGCCTGG + Intergenic
1136409056 16:30065918-30065940 GAGGGGCGCTCACCTGGCACAGG - Intronic
1136691347 16:32033172-32033194 GTGAGGTGCTCACCTGGTTCTGG + Intergenic
1136772654 16:32855381-32855403 GTGAGGAGCTCACCTGGTTCTGG + Intergenic
1136791935 16:32976737-32976759 GTGAGGTGCTCACCTGGTTCTGG + Intergenic
1136877882 16:33877171-33877193 GTGAGGTGCTCACCTGGTTCTGG - Intergenic
1136897960 16:34006138-34006160 GTGAGGAGCTCACCTGGTTCTGG - Intergenic
1138153634 16:54682965-54682987 GTGAGAGGATCACTTGGGCCTGG - Intergenic
1138220320 16:55244879-55244901 GTGGGAGGATCACCTGGGCCTGG - Intergenic
1138314811 16:56060830-56060852 AGGAGAGGCTCTCCTGGGCCTGG - Intergenic
1138468058 16:57208491-57208513 GTGGGGTGATCACCTGGGCCAGG - Intronic
1138525872 16:57606995-57607017 GAGAGAGGCCCGCGTGGGCCAGG - Intergenic
1139209462 16:65062903-65062925 CAGAGGGGCTGACGTGAGCCAGG + Intronic
1139282792 16:65784671-65784693 GAGAGGCCCTCACTGGGGCCAGG + Intergenic
1139843004 16:69897194-69897216 GCGAGAGGATCACCTGAGCCTGG - Intronic
1140213514 16:72989291-72989313 GACAGGGTTTCACCTTGGCCTGG - Intronic
1140843142 16:78860907-78860929 GTGGGAGGATCACCTGGGCCTGG - Intronic
1142164414 16:88578218-88578240 GAGAGGGCACCAGCTGGGCCAGG + Intronic
1142184154 16:88686445-88686467 GGGAGGGGCGCGCCTGGGTCCGG + Exonic
1142189089 16:88709373-88709395 GTGCTGGGCTCAACTGGGCCAGG - Intronic
1142291789 16:89196448-89196470 CAGAGGGGCCGGCCTGGGCCTGG - Intronic
1203075079 16_KI270728v1_random:1117491-1117513 GTGAGGAGCTCACCTGGTTCTGG + Intergenic
1203094146 16_KI270728v1_random:1238201-1238223 GTGAGGTGCTCACCTGGTTCTGG + Intergenic
1142718619 17:1762153-1762175 GGGAGAGGCTCCCCTGGGCTGGG + Intronic
1142721652 17:1780309-1780331 GAGATAGGGTCACCTGAGCCTGG - Exonic
1142977676 17:3655540-3655562 GGGAGGGGCTGAGCTGGGCAAGG - Intronic
1143090259 17:4445828-4445850 GAAAAGGGCTCCCCTGGGCAGGG + Intronic
1143171957 17:4935519-4935541 GAGGGAGGATCACCTGAGCCTGG + Intergenic
1143224874 17:5292773-5292795 GTGAGAGGATCACCTGAGCCCGG - Intronic
1143586877 17:7854881-7854903 GGGAGGGGCTCACCCTCGCCAGG - Intergenic
1143783239 17:9240258-9240280 GAGACGCGCTTCCCTGGGCCTGG + Exonic
1143928407 17:10394236-10394258 GTGAGGGTCTCACCTGGGTGTGG + Exonic
1144507419 17:15844284-15844306 TATAGGAGCTCACCTGTGCCTGG + Intergenic
1144726568 17:17505371-17505393 GTCAGGGGCTCACCTGGCCATGG - Intergenic
1144728080 17:17511722-17511744 GGGAGGGGCTCCCCTTGGACAGG + Intronic
1144757731 17:17690154-17690176 GTGAGTGGATCACCTGAGCCCGG + Intronic
1144822679 17:18086547-18086569 GAGGGAGGATCACCTGAGCCTGG + Intergenic
1144938858 17:18922765-18922787 GTGAGAGGATCACTTGGGCCCGG - Intronic
1145171544 17:20661889-20661911 TATAGGAGCTCACCTGTGCCTGG + Intergenic
1145179304 17:20731703-20731725 GACAGGGTCTCACCTTGCCCAGG + Intergenic
1145773935 17:27513579-27513601 GAGAGTGGCTCACCTTAGCAAGG + Intronic
1145917371 17:28583069-28583091 GTGAGAGGATCACCTGAGCCTGG - Intronic
1146278124 17:31528344-31528366 GAGAGGGGCTCACTATGTCCAGG - Intronic
1146652852 17:34617070-34617092 GAGAGGTGATGACTTGGGCCCGG - Intronic
1146653288 17:34620413-34620435 GAGAGGTGATGACTTGGGCCCGG - Intronic
1147340519 17:39750956-39750978 GACAGGGACTCACCTGCGACAGG + Intergenic
1147636795 17:41968849-41968871 GAGAGAGGCTCACCTCAGCGGGG + Intronic
1147782844 17:42956136-42956158 GAGAGGGGATCACATGGGGCTGG - Intronic
1148173610 17:45545244-45545266 GTGAGAGGATCACTTGGGCCTGG + Intergenic
1148275659 17:46300205-46300227 GTGAGAGGATCACTTGGGCCTGG - Intronic
1148297769 17:46517781-46517803 GTGAGAGGATCACTTGGGCCTGG - Intronic
1148362317 17:47022262-47022284 GTGAGAGGATCACTTGGGCCTGG - Intronic
1148563470 17:48619520-48619542 GAGAGAGCCGCAGCTGGGCCGGG - Intronic
1148665217 17:49369584-49369606 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1148879962 17:50718211-50718233 GCGAGGGGGTCGCCTGAGCCCGG + Intergenic
1148883161 17:50748407-50748429 GTGGGAGGATCACCTGGGCCGGG - Intronic
1149332229 17:55596057-55596079 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1149504837 17:57185601-57185623 GAGATGGGGTCAGCTGGGCATGG + Intergenic
1149685599 17:58532757-58532779 AAGAGTGGCCCAGCTGGGCCTGG - Intronic
1149909445 17:60553518-60553540 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1150404817 17:64892159-64892181 GTGAGAGGATCACTTGGGCCTGG + Intronic
1150426934 17:65084677-65084699 GAGGGAGGATCACCTGAGCCTGG + Intergenic
1150451517 17:65272642-65272664 GAGAAGGATTCACATGGGCCTGG + Intergenic
1151248430 17:72814722-72814744 CAGAGAGGATCACCTGGGGCTGG + Intronic
1151425905 17:74030936-74030958 GACTGGGGCACACCTGGACCTGG - Intergenic
1151631035 17:75310995-75311017 GAGAGTGGATCACCTGAGGCTGG + Intergenic
1151700348 17:75739607-75739629 TGGAAGGGCTTACCTGGGCCAGG + Intronic
1151718883 17:75844721-75844743 GAGAGAAGCTGACCTGGGCCCGG + Intergenic
1151869632 17:76827563-76827585 GTGAGAGGATCACCTGAGCCCGG - Intergenic
1152002308 17:77654475-77654497 GACAGCGCCTCACCTGGGCAAGG + Intergenic
1152199255 17:78935545-78935567 GGGAGGGGCCCAGCTGGGGCGGG + Intergenic
1152435065 17:80271463-80271485 GACAGGGGCGCAGCTGGGACTGG + Intronic
1152825521 17:82462319-82462341 GACAGTGGCTCCCCTTGGCCAGG + Intronic
1153051656 18:907140-907162 GAGAAGGGCTCCCCTGGGCTCGG + Intronic
1153747790 18:8198238-8198260 GTGGGAGGATCACCTGGGCCTGG - Intronic
1153902725 18:9632825-9632847 GTGAGAGGATCACCTGGGCCTGG - Intergenic
1154403322 18:14063787-14063809 GAGCGGGTCTCATCTGTGCCTGG - Intronic
1156279473 18:35621270-35621292 GTGGGGGGATCACTTGGGCCTGG - Intronic
1156888009 18:42157991-42158013 GAGTGGGCCTCACCAGGGGCTGG - Intergenic
1157719620 18:49913884-49913906 GAGAGGAGTTCACCTGGGGGTGG + Intronic
1160256389 18:77251318-77251340 GAGTGGGGACCACCGGGGCCAGG - Intronic
1160453278 18:78979556-78979578 GAGCGGGGGGCACCTGAGCCCGG + Intergenic
1160729177 19:632952-632974 GAGAGCGGCTGAGCGGGGCCGGG + Intronic
1160739997 19:681183-681205 GAGGGGGGCTCACGGGGGGCGGG + Intronic
1160841272 19:1147946-1147968 GAGAGAGGCGCCCCTGGGCGGGG - Intronic
1160842077 19:1150693-1150715 GAGCAGGGCTCACGTGGGCCTGG - Intronic
1160919160 19:1511859-1511881 GGGAGGGGGTGACCTGGCCCAGG + Intronic
1161081822 19:2314745-2314767 GGGTGGGGGTCACCTGAGCCTGG - Intronic
1161221309 19:3119429-3119451 GAGAGGGGCTCATACAGGCCGGG + Intronic
1161248292 19:3267218-3267240 GGGGGGGGCTCCCCTGTGCCAGG - Intronic
1161320119 19:3637225-3637247 GAGAGGGGCTCGCTGGGGTCTGG + Intronic
1161447526 19:4326929-4326951 AAGGGGGCGTCACCTGGGCCCGG + Exonic
1161458582 19:4382550-4382572 GAAAGCGGAGCACCTGGGCCGGG - Intronic
1161661091 19:5546792-5546814 GAGAGAGGATCACTTGGGTCCGG - Intergenic
1162017266 19:7852362-7852384 CAGAGGGGGCCAGCTGGGCCGGG + Intronic
1162242052 19:9363075-9363097 TAGTGGGGCGCACCTGGACCTGG - Intronic
1162472262 19:10879500-10879522 GAGAGGTGCTCCAGTGGGCCAGG + Intronic
1162584333 19:11549859-11549881 GAGAGGGGGTCGGCTGGGCCTGG - Exonic
1163001263 19:14369229-14369251 GAGAGAGGATCAGTTGGGCCAGG - Intergenic
1163026843 19:14517780-14517802 GACCCGGGCTCACCTGGGCTCGG - Intronic
1163101564 19:15100347-15100369 GACAGGGCCTCAGCTGGGCACGG + Intergenic
1163417183 19:17193782-17193804 GTGGGAGGATCACCTGGGCCTGG + Intronic
1163627499 19:18398468-18398490 GAGAAGGCCTCACCTGAACCTGG + Intergenic
1163710882 19:18846122-18846144 GAGCTGAGCTCAGCTGGGCCTGG + Intronic
1163749219 19:19065256-19065278 GAGAGGGGGTTGCCGGGGCCGGG + Intronic
1164520038 19:28972183-28972205 TGGAGGGGTTGACCTGGGCCTGG + Intergenic
1164660305 19:29959216-29959238 GCGAGAGGATCACCTGAGCCTGG - Intronic
1164889314 19:31809506-31809528 GAGGGAGGATCACCTGGGCCTGG + Intergenic
1165017342 19:32890714-32890736 TTGAGGGGCTCCCCTGGGGCTGG - Intronic
1165297836 19:34942351-34942373 GGGAGGGAATCACCTGAGCCTGG + Intronic
1165357065 19:35310825-35310847 GTCAGGGGCACACCAGGGCCTGG + Intronic
1165406282 19:35633135-35633157 GAGGGGGGCCCACGAGGGCCTGG - Exonic
1165419464 19:35715821-35715843 GCGAGGGGCTTACCTGGGGTAGG - Exonic
1165569415 19:36762982-36763004 GTGAGAGGATCACCTGAGCCTGG - Intronic
1165747517 19:38238814-38238836 GAGGGAGGATCACCTGAGCCTGG + Intergenic
1165844133 19:38807272-38807294 GTGAGAGGATCACCTGAGCCCGG + Intronic
1166311723 19:41966876-41966898 GACAGGGGCGGTCCTGGGCCTGG + Exonic
1166608029 19:44162838-44162860 GAGAGTGGCTCACCATGCCCCGG - Intergenic
1166993648 19:46708409-46708431 GTGGGAGGATCACCTGGGCCTGG - Intronic
1167098277 19:47387528-47387550 GTGAGAGGATCACCTGAGCCCGG - Intergenic
1167211369 19:48136021-48136043 CACAGGAGCTCACCTTGGCCCGG + Exonic
1167416412 19:49375443-49375465 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1167444801 19:49531223-49531245 GAGGGAGGATCACTTGGGCCTGG + Intronic
1167461099 19:49625191-49625213 GGGTGGGGCTCACCTGGTCCCGG - Exonic
1167472125 19:49681141-49681163 GTGGGGGGATCACCTGAGCCGGG - Intronic
1167472865 19:49685083-49685105 GAGAGGCCATCACCTGGCCCTGG + Intronic
1167485346 19:49759539-49759561 GTGGGAGGATCACCTGGGCCTGG + Intronic
1167499430 19:49836860-49836882 GAGCGGGGGTCCCCGGGGCCCGG + Exonic
1167569870 19:50280374-50280396 TAGGGCTGCTCACCTGGGCCTGG - Exonic
1167620638 19:50558322-50558344 GTGGGAGGATCACCTGGGCCTGG - Intronic
1167698211 19:51027167-51027189 GCCAGGGGCCCACCTGGGCTGGG - Intronic
1168118860 19:54240918-54240940 GGGAGGGGCTCACAGGGCCCAGG + Exonic
1168169293 19:54575443-54575465 GGGAGGGGCTCACAGGGCCCAGG - Exonic
1168345845 19:55649886-55649908 GAGAGGGGCTCTCAGGTGCCAGG - Intronic
924993973 2:340457-340479 GGGAGGGGCACAGCTGGGTCAGG - Intergenic
924993982 2:340479-340501 GAGAGGGACACACCTGGGGCAGG - Intergenic
924993997 2:340523-340545 GGAAGGGGCACACCTGGGACAGG - Intergenic
924994005 2:340545-340567 GGGAGGGGCACACCTGGGTCAGG - Intergenic
924994014 2:340567-340589 GGAAGGGGCACACCTGGGACAGG - Intergenic
924994022 2:340589-340611 GGGAGGGGCACACCTGGGTCAGG - Intergenic
924994031 2:340611-340633 GGGAGGGGCACACCTGGGTCAGG - Intergenic
925171179 2:1751084-1751106 GAGAGTATTTCACCTGGGCCCGG - Intergenic
925281997 2:2691186-2691208 GACAGTGGCAGACCTGGGCCGGG - Intergenic
925342230 2:3145665-3145687 GAGAGGGGCTCTGGAGGGCCAGG - Intergenic
927267051 2:21162780-21162802 GAGAGGTGCCCCCCTGGGCAGGG - Intergenic
928176166 2:29035647-29035669 AAGCGGTGCTCACCTGGACCAGG - Exonic
929606964 2:43241063-43241085 AAGAGGGGTCCACCTGGGCCCGG - Intronic
931053043 2:58435480-58435502 AAGAATGTCTCACCTGGGCCAGG - Intergenic
933727183 2:85433622-85433644 GGGAGGGGCTCACCTGGATCCGG - Intronic
934076390 2:88432160-88432182 GAGATGGGATCACCTGAGCCCGG + Intergenic
934739028 2:96705754-96705776 GAAAGGGGGTCACCTTGGCTAGG - Intergenic
934876332 2:97924287-97924309 GCGAGAGGTTCACTTGGGCCCGG + Intronic
935309095 2:101765421-101765443 GCAAGGGGGTCACCTGAGCCCGG - Intronic
936605474 2:113948241-113948263 GTGAGAGGATCACCTGAGCCTGG - Intronic
937144184 2:119628098-119628120 GAGAGGGCCCCACCTGGCCCAGG + Intronic
937258197 2:120569350-120569372 GTTAGTGGCACACCTGGGCCTGG + Intergenic
937308263 2:120885424-120885446 GAGGGTGGCTCCCCTGAGCCTGG + Intronic
937324461 2:120982084-120982106 GAGAGGGAGGGACCTGGGCCAGG + Intronic
937340514 2:121087829-121087851 GAGAGGGGCTCAGAGGGGCTTGG + Intergenic
937351827 2:121170433-121170455 GTGAGGGGATCACTTGGGCCTGG - Intergenic
937377315 2:121346250-121346272 GAGAGGAGGCCAGCTGGGCCTGG - Intronic
938693571 2:133815151-133815173 GAGAGAGGCTCACCAGTGCAGGG + Intergenic
939032376 2:137092317-137092339 GTGGGAGGATCACCTGGGCCTGG + Intronic
939984241 2:148814332-148814354 GTGGGAGGATCACCTGGGCCAGG + Intergenic
940783033 2:157953335-157953357 GAGAGAGGATCACCTGAGCCTGG - Intronic
941197330 2:162468942-162468964 GAGGGAGGGTCACCTGGGCCTGG - Intronic
941785643 2:169495747-169495769 GAGAGAGGATCACCTGAGCCTGG - Intronic
941866759 2:170343494-170343516 GAGAAGGTGTTACCTGGGCCAGG - Intronic
942639012 2:178041031-178041053 GAGAGAGGATCACTTGAGCCTGG - Intronic
944156629 2:196613889-196613911 GAGGGGGGATCACCTGAGGCTGG - Intergenic
944315779 2:198284382-198284404 GAGGGAGGATCACCTGAGCCTGG + Intronic
944757100 2:202774597-202774619 GAGAGGGGGTCACATGGGAGGGG + Exonic
945040236 2:205737943-205737965 GAGTGTGGCTCACATGGGCATGG - Intronic
945852085 2:215020937-215020959 GTGAGAGGATCACCTGAGCCTGG - Intronic
945899589 2:215523046-215523068 GTGAGAGGATCACCTGAGCCTGG + Intergenic
946352959 2:219167646-219167668 GTGGGAGGATCACCTGGGCCTGG + Intronic
946418415 2:219551979-219552001 CCGAGGGGCTCTCCTGGGCCGGG - Intronic
946759693 2:222981365-222981387 GAGAGTGGCTCTGCTGGGCCAGG - Intergenic
947649699 2:231775401-231775423 GTGAGGGGATCACCTGAGCCTGG - Intronic
948273253 2:236689667-236689689 GAGAGAGGATCACTTGAGCCTGG - Intergenic
948466230 2:238153055-238153077 GAGTGGGCCTCTCCAGGGCCTGG + Intergenic
948806778 2:240456482-240456504 GAGATGGGCTCAGCTGTGACGGG - Intronic
948838108 2:240636009-240636031 GATATGGGCTCTCCTGGGCATGG - Intergenic
948872679 2:240811617-240811639 GAGAGGGGCACCTCTGGGACAGG + Intronic
948900762 2:240955896-240955918 GTGAGGAGCTCTCCAGGGCCAGG + Intronic
948994732 2:241572593-241572615 GGGAGGGGCTTTCCTGAGCCTGG + Exonic
1168895250 20:1319641-1319663 GTGAGGCTCTGACCTGGGCCTGG + Exonic
1169095234 20:2891992-2892014 TAGAGAGGGTCAACTGGGCCGGG + Intronic
1170059022 20:12240106-12240128 GAGACTGGCTGGCCTGGGCCAGG + Intergenic
1171486415 20:25489561-25489583 GAGAGGGGCTGCCCAGGGTCAGG - Intronic
1171528770 20:25837380-25837402 GTGAGAGGATCACCTGAGCCTGG - Intronic
1171548056 20:26018506-26018528 GTGAGAGGATCACCTGAGCCTGG + Intergenic
1172474296 20:35226181-35226203 CTGAGTGGCTCTCCTGGGCCGGG - Intergenic
1172551796 20:35806251-35806273 GTGAGAGGATCACCTGAGCCTGG - Intronic
1172750067 20:37244586-37244608 GTGGGGGGATCACCTGAGCCTGG - Intergenic
1172762485 20:37332251-37332273 GACAGGGGCTGAGATGGGCCTGG + Intergenic
1172882520 20:38211266-38211288 GAGAGAGGCAGGCCTGGGCCAGG - Exonic
1172938240 20:38636354-38636376 GTGAGAGGGTCACCTGAGCCTGG - Intronic
1172970062 20:38866646-38866668 GAGGGTGGGTCTCCTGGGCCTGG + Intronic
1172992658 20:39047823-39047845 GAGTGGGGCCCGCCTGGCCCTGG + Intergenic
1173448150 20:43138549-43138571 TGGAGGGGCCCACCTGTGCCCGG - Intronic
1174250033 20:49212277-49212299 AAAAGGTGCTCACCTGGGCATGG - Intergenic
1174476881 20:50801959-50801981 GACAGGGCCACACCAGGGCCTGG + Intronic
1175172394 20:57089856-57089878 GAGAGGGGCTGCCCAGCGCCAGG + Intergenic
1175389087 20:58615105-58615127 GGTAGGGGCTCACCTGCGCCAGG - Intergenic
1175962891 20:62646039-62646061 GAGAGTGGCCCAGCTGTGCCAGG + Intronic
1176096070 20:63345184-63345206 GAGCCGAGCTCTCCTGGGCCAGG - Exonic
1176197493 20:63844213-63844235 GAAAGGGGCTTGCCTGGTCCTGG + Intergenic
1177047203 21:16185183-16185205 GAGAGGGACTCAACTGGGTCTGG + Intergenic
1178094278 21:29197407-29197429 GAGAGGAGCTCAGCTGGGGGTGG + Intronic
1179411956 21:41168707-41168729 CAGAGGGGCTCGGGTGGGCCGGG + Intronic
1179529626 21:42009891-42009913 GAGGGGCGCGCGCCTGGGCCAGG + Intronic
1180041372 21:45282067-45282089 GGGAGGGGCTGAGCTGGGCTGGG - Intronic
1180136140 21:45863252-45863274 CAGCGGGGCTGACCTGGGCTTGG - Intronic
1180605607 22:17056968-17056990 GAGAGGGGCTCCTGTGGGGCTGG - Intergenic
1181023115 22:20113673-20113695 CAGGAGGGCTCACCCGGGCCAGG + Exonic
1181050359 22:20235429-20235451 GAGAGGGCCCTGCCTGGGCCTGG - Intergenic
1181256155 22:21564127-21564149 GTGAGAGGATCACTTGGGCCCGG - Intronic
1181275436 22:21684991-21685013 GAAAGGGGCTCATGGGGGCCTGG + Intronic
1181518540 22:23432232-23432254 GAGAGGAGGTCACCCTGGCCTGG + Intergenic
1181670055 22:24421746-24421768 GAGAGGGGGGCACCAGGGCCAGG + Intronic
1182308667 22:29388968-29388990 GTGAGAGGATCACCTGAGCCTGG - Intronic
1182459142 22:30471892-30471914 GAGGGGCTCTCACCTTGGCCAGG + Exonic
1182467463 22:30526146-30526168 GAGAGGGGCAGGCCTGGGACAGG - Intronic
1182502189 22:30755752-30755774 AAGAGGGGCAAACCTGGCCCAGG + Intronic
1183348032 22:37318734-37318756 GAGAGGGTCCCCACTGGGCCAGG - Intergenic
1183404079 22:37621569-37621591 GTGAGGGCAGCACCTGGGCCAGG - Intronic
1183500297 22:38174878-38174900 GAGAGGAGCTTCCCTGGGCATGG - Intronic
1183500345 22:38175101-38175123 GAGAGGGGACTGCCTGGGCCTGG - Intronic
1183529689 22:38346716-38346738 CTGTGGGGCTCACCTGGGTCCGG + Intronic
1183858051 22:40649573-40649595 GTGAGAGGATCACCTGAGCCTGG + Intergenic
1184412072 22:44331431-44331453 GGGAGGGGCGCGCCTGGGCCGGG - Intergenic
1184462937 22:44649580-44649602 GAGGGAGGATCACTTGGGCCTGG + Intergenic
1184476593 22:44725348-44725370 CACAGGGGCTCACCTGCCCCCGG + Intronic
1184682580 22:46080088-46080110 GGGAGCGGCTTGCCTGGGCCTGG - Intronic
1184703087 22:46190654-46190676 GTGAGAGGATCACCTGGGCCCGG + Intronic
1184850103 22:47115068-47115090 GAGAGGGGCACAGCTGGGATTGG + Intronic
1184896915 22:47414235-47414257 GTGGGAGGCTCACCTGGGCCTGG + Intergenic
950090619 3:10291783-10291805 GAGAGGAGCTCACCTTAGGCTGG + Intronic
950301114 3:11879984-11880006 GTGAGAGGATCACCTGAGCCTGG - Intergenic
950358238 3:12429658-12429680 GAGAGAGGCCCTCCTGGGCTGGG - Intronic
951546525 3:23831608-23831630 GGGAGGGGATCACCTGAGCCTGG - Intronic
952318981 3:32258601-32258623 GTGAGAGGCTCACTTGAGCCTGG - Intronic
953552573 3:43915131-43915153 CAGAGGGCCTCACCTAGGCAAGG - Intergenic
953863020 3:46561457-46561479 GTGAGAGGATCACTTGGGCCTGG + Intronic
953932510 3:47012756-47012778 GAAAGGGGCTCACCCTGGCTGGG - Intergenic
954122543 3:48507988-48508010 GAGAAGTTCTCACCAGGGCCGGG + Intergenic
954271471 3:49513144-49513166 TAGAGTGGCTCACCTGGGGCTGG + Intronic
955012638 3:55033407-55033429 GAGAGGGACACACCAGGGCTTGG - Intronic
956628128 3:71287376-71287398 GGGAGAGGATCACCTGAGCCTGG + Intronic
956758638 3:72416422-72416444 GTGAGAGGATCACCTGAGCCTGG + Intronic
956819387 3:72939773-72939795 GTGAGGGAATCACCTGAGCCTGG - Intronic
957617767 3:82553372-82553394 GACAGGGGCTCTGCTGGGCCTGG - Intergenic
958785446 3:98593006-98593028 GAGCCTGGCACACCTGGGCCTGG + Exonic
959942544 3:112094816-112094838 GAGAGGGGCTCGACTGAGGCTGG + Intronic
960209767 3:114948575-114948597 GAGAGAGATTCACCTTGGCCAGG - Intronic
960322266 3:116250773-116250795 GGTAGGGGATCACTTGGGCCTGG + Intronic
960971245 3:123141609-123141631 GTGGGGGGCTCACCTTGGACAGG + Intronic
961457471 3:127031317-127031339 GAGAGGGGCTCCCCTGTAGCAGG - Intronic
961470300 3:127107192-127107214 GAGAAGGCCCCACCTGTGCCTGG + Intergenic
961640813 3:128363813-128363835 GAGAGTGGCCCTCGTGGGCCTGG - Intronic
961734593 3:128993624-128993646 GGGAGCTGCTCACCTGGGGCAGG - Intronic
961866855 3:129959691-129959713 GAGTGAGGATCACCTGAGCCTGG - Intergenic
962810006 3:138951568-138951590 AAGAGGGCCTCACTTGGCCCAGG - Exonic
963009769 3:140758479-140758501 GAGAGAGGAGCACCTGGGGCAGG + Intergenic
966163181 3:176989238-176989260 GTGGGAGGCTCACCTGAGCCTGG + Intergenic
966767445 3:183476041-183476063 GTGAGAGGATCACCTGAGCCTGG - Intergenic
967838079 3:193981101-193981123 GAGTGGGGAACTCCTGGGCCAGG + Intergenic
968127459 3:196170214-196170236 GAGAGGGGAGCCACTGGGCCAGG + Intergenic
968514941 4:1011945-1011967 GCGGGGGGCTCACCTCGGCGGGG - Intronic
968614556 4:1571480-1571502 GGCAGGGCCTCACCTGGGCTGGG + Intergenic
968754598 4:2408802-2408824 GGGCGGGGCTCACCTGGGCGTGG - Intronic
968815918 4:2821651-2821673 CTGAGGGGATCACCTGAGCCTGG - Intronic
968968749 4:3782541-3782563 GGGAGGGGCCCACCTGGGGAAGG - Intergenic
969283414 4:6186920-6186942 GTGAGAGGATCACCTGAGCCTGG - Intronic
969336418 4:6512745-6512767 GATAAGACCTCACCTGGGCCAGG + Intronic
969514353 4:7638232-7638254 GAGAGAGGCGCACCTGGCCCAGG + Intronic
969582139 4:8071714-8071736 GATGGGGGCTCACAGGGGCCAGG - Intronic
971411899 4:26382633-26382655 GTGAGAGGATCACCTGAGCCTGG - Intronic
971417883 4:26450373-26450395 GAGAGCAGCTCAACTGGGCGAGG - Intergenic
972477328 4:39463177-39463199 GAGAGAGGATCACTTGAGCCTGG - Intronic
972518715 4:39833480-39833502 GTGAGGGGATCACCTGAGCCTGG - Intronic
972686785 4:41360355-41360377 CAGTGGGGCGCACCCGGGCCCGG - Intronic
972780465 4:42282856-42282878 GAGAAGGGCCCAGCGGGGCCAGG - Intergenic
976318637 4:83686354-83686376 GAGAGAGGCTCCCCTTGCCCTGG - Intergenic
976518664 4:86001625-86001647 GACAGGTGCTCACGTGGGCATGG - Exonic
978235723 4:106456501-106456523 GTGAGAGGATCACTTGGGCCTGG + Intergenic
978778616 4:112526809-112526831 GTGAGAGGATCACCTGAGCCAGG - Intergenic
978792490 4:112677157-112677179 GTGGGGGGATCACCTGAGCCTGG + Intergenic
979241373 4:118449731-118449753 GAGAGAGGATCACTTGAGCCTGG - Intergenic
981508136 4:145525631-145525653 GAGCTGGGCTGAGCTGGGCCAGG + Intronic
982224657 4:153154359-153154381 CAGAGGGGCTTACCAGAGCCAGG + Intronic
982437043 4:155391915-155391937 GAGAGAGGATCACTTGGGCCAGG + Intergenic
982560740 4:156925956-156925978 GTGAGAGGATCACCTGAGCCTGG + Intronic
983204932 4:164902163-164902185 GAGAGAGGCTCAGCAGGGGCTGG - Intergenic
983299594 4:165908487-165908509 GTGAGAGGATCACCTGAGCCTGG + Intronic
985690596 5:1309603-1309625 GTGAGAGGATCACCTGTGCCTGG + Intergenic
985802337 5:2012978-2013000 GACCGGGCCTCGCCTGGGCCAGG - Intergenic
985853362 5:2405554-2405576 GAGATGGGCTTACCTGGAGCAGG + Intergenic
988576822 5:32433973-32433995 GAGGGAGGATCACCTGTGCCTGG + Intronic
990423435 5:55660317-55660339 GTGAGAGGATCACCTGAGCCTGG + Intronic
991034263 5:62112469-62112491 GTGGGAGGATCACCTGGGCCTGG - Intergenic
992997583 5:82348103-82348125 GTGAGAGGATCACCTGAGCCTGG - Intronic
993713778 5:91254137-91254159 GTGAGAGGATCACCTGAGCCTGG - Intergenic
995703534 5:114961684-114961706 GAGGGGGGCTCACATGGCCTTGG + Intergenic
995791794 5:115896683-115896705 GAAAGAGGATCACCTGTGCCTGG + Intronic
996296847 5:121928915-121928937 GAGGGAGGATCACCTGAGCCTGG + Intergenic
996297089 5:121932162-121932184 GCAAGAGGCTCACCTGAGCCTGG + Intergenic
996572943 5:124952129-124952151 GTGGGAGGATCACCTGGGCCTGG - Intergenic
997076514 5:130685069-130685091 GTGAGGGGATCGCTTGGGCCTGG + Intergenic
997562911 5:134864128-134864150 GAGAAGGGGTCAGCTGGGCGCGG - Intergenic
998798557 5:145844385-145844407 GTGGGAGGATCACCTGGGCCTGG + Intergenic
999282700 5:150375545-150375567 GAAGGGGCCTCACCTGAGCCGGG - Exonic
999387276 5:151163239-151163261 GTGAGGGGATCACCTGATCCTGG - Intergenic
1000033468 5:157423325-157423347 GTAAGAGGATCACCTGGGCCTGG - Intronic
1001499323 5:172216870-172216892 GTGAGGGGATCACTTGAGCCCGG + Intronic
1001637272 5:173220039-173220061 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1002023672 5:176382660-176382682 GAGGGAGGATCACTTGGGCCGGG + Intronic
1002029645 5:176418341-176418363 GTGAGGGAATCACCTGAGCCCGG + Intergenic
1002078172 5:176721974-176721996 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1002137619 5:177117552-177117574 GTGAGGGGATCACTTGAGCCCGG + Intergenic
1002431608 5:179207428-179207450 CAGAGAGGCCCAGCTGGGCCAGG - Intronic
1002661576 5:180794293-180794315 GAGATGGGATCACCTGAGTCTGG + Intronic
1002825184 6:765869-765891 GAGAGGGGCTGACTAGGGCCAGG - Intergenic
1003133465 6:3415275-3415297 GAGAGGGGCAGTCCTTGGCCAGG - Intronic
1004194665 6:13492250-13492272 AAGAGGGTTTCACATGGGCCGGG - Intergenic
1005149751 6:22735404-22735426 GTGAGAGGATCACCTGAGCCAGG - Intergenic
1005304993 6:24504976-24504998 GAGAGCGGCTCACCTCAGCCAGG - Exonic
1005306228 6:24516827-24516849 GTGAGAGGATCACCTGAGCCTGG + Intronic
1006047249 6:31308308-31308330 GGGCGGGGCACACCTGTGCCCGG + Intronic
1006104797 6:31710172-31710194 GGGAGGGACTCACCTCTGCCTGG - Exonic
1006117338 6:31782221-31782243 GAGCAGGGCTCACTCGGGCCAGG - Intronic
1006167054 6:32071183-32071205 GAAAGGGGCACAGCTGGGCTGGG + Intronic
1006193367 6:32222794-32222816 GCCAGGGGCACACCTGGGCAGGG + Exonic
1006581818 6:35081728-35081750 GAGACGGGCCCACCTCCGCCAGG - Intronic
1006761947 6:36470692-36470714 GTGAGAGGCTCACTTGAGCCTGG - Intronic
1006984616 6:38168371-38168393 CAGAGGGGCTGACCCTGGCCTGG + Intergenic
1007392081 6:41555375-41555397 TAGAGGGGCTCACCCTGGCAGGG - Intronic
1008856071 6:56088878-56088900 GTGGGGGGATCACCTGAGCCTGG - Intronic
1009566170 6:65313706-65313728 GAGATGGGGTGGCCTGGGCCAGG - Intronic
1010975428 6:82307271-82307293 GACAGAGGCTCTCCTGGGGCTGG - Intergenic
1011704299 6:89985595-89985617 CAGAGGGCCTCAGCTGGGCAGGG + Intronic
1012090577 6:94889417-94889439 GAGGGAGGATCACCTGAGCCTGG - Intergenic
1012820269 6:104078251-104078273 GAGGGAGGATCACCTGAGCCTGG - Intergenic
1013150768 6:107444119-107444141 GAGAGAGGATCACTTGAGCCTGG - Intronic
1013179788 6:107708131-107708153 GACAGGAGGTCACTTGGGCCAGG - Intronic
1013288511 6:108700083-108700105 GGCAGGGCCTCACCTGAGCCAGG - Intergenic
1014401523 6:120996271-120996293 GTGGGAGGATCACCTGGGCCTGG + Intergenic
1015208905 6:130672908-130672930 GAGAGGCACTTAGCTGGGCCTGG - Intergenic
1015920952 6:138266117-138266139 GCGGGGGGATCACTTGGGCCTGG + Intronic
1016940446 6:149479003-149479025 GAGAAGGGGTCAGGTGGGCCAGG - Intronic
1017013234 6:150079186-150079208 GTGGGAGGATCACCTGGGCCTGG + Intergenic
1017678881 6:156843558-156843580 CCGAGGGGCACACCTGGGCTGGG + Intronic
1017962115 6:159232334-159232356 GAGGGGGGCGCCCCTGGGCGGGG - Exonic
1019390551 7:784229-784251 GTGAGGGGCCCACATGGGCGAGG - Intronic
1019395368 7:815481-815503 GTGGGAGGATCACCTGGGCCGGG + Intergenic
1019440138 7:1041832-1041854 GAGAGGGGCCCAGCTGGCCTGGG - Intronic
1019796555 7:3054221-3054243 GAGAGTGGCTCATAGGGGCCTGG + Intergenic
1019910446 7:4097227-4097249 GTGAGGGGCTCACCTGGGTCAGG + Intronic
1020142666 7:5621102-5621124 GACAGGTGGTCACCTGGACCTGG - Intronic
1021312690 7:19112658-19112680 GCGAGGGTCTCACCTGCGGCAGG - Intronic
1022198416 7:28092764-28092786 GTGGGAGGATCACCTGGGCCTGG + Intronic
1023142017 7:37111054-37111076 GAGAGAGGCCCACATGGTCCTGG - Intronic
1024045935 7:45585740-45585762 AAGATGTGCCCACCTGGGCCAGG - Intronic
1026903099 7:74047796-74047818 GCGAGGTGCTCTCCTGGCCCAGG - Intronic
1027184136 7:75960195-75960217 GTGAGAGGATCACCTGAGCCTGG + Intronic
1027608125 7:80325356-80325378 GTGAGAGGGTCACCTGGGCCTGG + Intergenic
1027781248 7:82523087-82523109 GAGGGAGGCTCACCTGAGCCTGG + Intergenic
1028876072 7:95824776-95824798 GAGAGGAGCACTCCTGGCCCCGG - Intronic
1028909715 7:96194346-96194368 GTGAGAGGATCACCTGAGCCTGG + Intronic
1029230592 7:99065186-99065208 GTGGGAGGCTCACCTGAGCCTGG - Intronic
1029497305 7:100902894-100902916 GAGAGGTGCCCAGCAGGGCCAGG + Intergenic
1030315294 7:108108032-108108054 GTGGGAGGATCACCTGGGCCTGG - Intronic
1032310486 7:130781682-130781704 ACCAGGGGCTCCCCTGGGCCAGG + Intergenic
1032319149 7:130868838-130868860 GTGAGAGGATCACCTGAGCCTGG + Intergenic
1032351464 7:131167576-131167598 GTGAGAGGATCACCTGAGCCTGG + Intronic
1033319044 7:140323021-140323043 GAAAGGTGTTCTCCTGGGCCAGG + Intronic
1033621955 7:143069795-143069817 GAGGGGGACTCACCAGTGCCAGG + Intergenic
1034088234 7:148339597-148339619 GCGAGGGGCACACCTGAACCGGG + Intronic
1034520572 7:151616219-151616241 GAGAGAGGCTCTGCTTGGCCAGG + Intronic
1034781829 7:153888092-153888114 GAGAGGTGGTCACTTCGGCCAGG + Intronic
1034965908 7:155390724-155390746 GTGGGGGGATCACCTGAGCCTGG + Intronic
1035012039 7:155727857-155727879 GTGAGAGGATCACCTGAGCCCGG - Intronic
1035346231 7:158201142-158201164 GAGAGAGGATCACCTGAGCCCGG - Intronic
1035841858 8:2821635-2821657 GTGAGAGGATCACCTGGGCCTGG - Intergenic
1037798185 8:22014426-22014448 GTGAGAGGATCACCTGAGCCTGG + Intergenic
1037826238 8:22162279-22162301 GAGAGGGGCTGACCATGGCTGGG + Intronic
1038214385 8:25548488-25548510 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1038553805 8:28492381-28492403 GAGAGAGGATCACTTGAGCCAGG - Intergenic
1039537023 8:38325761-38325783 GTGAGAGGATCACCTGAGCCTGG + Intronic
1039864788 8:41491003-41491025 GAGAGAGACTCACCGGGGACGGG + Intronic
1041962719 8:63637138-63637160 GAGGGAGGATCACCTGAGCCTGG + Intergenic
1042711425 8:71721707-71721729 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1042893260 8:73636281-73636303 GTGGGGGGATCACCTGAGCCTGG + Intronic
1043388856 8:79771667-79771689 GGGAGGCCCTCACCTGGGCCTGG - Intergenic
1043817334 8:84817646-84817668 GAGGGAGGATCACTTGGGCCTGG - Intronic
1044047762 8:87459382-87459404 GAGAGGGGGTCTGCTGGGCAGGG + Intronic
1044871895 8:96627945-96627967 GGGGGAGGATCACCTGGGCCTGG - Intergenic
1044966238 8:97576435-97576457 GTGGGAGGCTCACCTGAGCCTGG + Intergenic
1045500897 8:102743677-102743699 AAGAGGTGTTCACCTGGGTCCGG + Intergenic
1046779579 8:118200911-118200933 GTGAGGGGATCACTTGAGCCTGG - Intronic
1047599223 8:126409579-126409601 GAGGGCGGCTCACTTGAGCCAGG - Intergenic
1047985609 8:130229969-130229991 GAGGGAGGATCACCTGAGCCTGG + Intronic
1048631044 8:136242708-136242730 GTGAGAGGATCACCTGAGCCTGG + Intergenic
1048969298 8:139635473-139635495 GAGGTGGGCTCACCAGGACCCGG - Intronic
1049180869 8:141221508-141221530 GAGAGGAGCTACCCAGGGCCAGG + Intronic
1049398033 8:142410964-142410986 GAGAGGGGCACTGCTGGGCAGGG - Intergenic
1049421211 8:142517452-142517474 GAGAGGAGCTCACAGGGGGCAGG + Intronic
1049444387 8:142623381-142623403 GACATGGGCTCACATGGCCCTGG - Intergenic
1049571325 8:143371562-143371584 GAGTGGGGCTGACCTGGGGACGG - Intronic
1049630774 8:143655399-143655421 GAAAGAGGCTCACTTGAGCCCGG - Exonic
1049655013 8:143793480-143793502 GTGAGGGGCTGAGCTGGGGCTGG + Intronic
1049777304 8:144412722-144412744 GGGAGGGGCTGCTCTGGGCCGGG - Intronic
1049822860 8:144646737-144646759 GCGAGGGTCTCACCAGGACCAGG - Intergenic
1051249855 9:15148555-15148577 GTGAGAGGATCACTTGGGCCTGG + Intergenic
1051740753 9:20249475-20249497 GCGGGTGGATCACCTGGGCCAGG + Intergenic
1052793643 9:32902207-32902229 GAGAGGAGTTCAGCTGGGCATGG + Intergenic
1053484372 9:38441055-38441077 GTGGGGGGATCACCTGGGCCAGG - Intergenic
1055320048 9:75074478-75074500 GCGAGAGGCTCACTTGAGCCCGG - Intronic
1055539438 9:77287293-77287315 GTGGGAGGATCACCTGGGCCAGG - Intronic
1056975481 9:91249201-91249223 GTGGGGGGATCACCTGAGCCTGG + Intronic
1057081618 9:92178080-92178102 GAAAGGGTCTCAGCTGGGCACGG + Intergenic
1057303373 9:93899170-93899192 GAGAGGGGCTGAGCAGAGCCAGG + Intergenic
1057571044 9:96204357-96204379 GGAAGGGGCTCTCCAGGGCCCGG + Intergenic
1057814824 9:98286745-98286767 GAGCAGGGGTCTCCTGGGCCAGG + Intergenic
1058013916 9:100008833-100008855 GTGAGAGGATCACCTGAGCCTGG - Intronic
1058265182 9:102890232-102890254 GAGATGGGCACACCTGGGGGGGG - Intergenic
1058742526 9:107958179-107958201 GTGAGAGGGTCACCTGAGCCTGG - Intergenic
1058890565 9:109357244-109357266 GAGAGGGGCTAAACAAGGCCTGG - Intergenic
1058909923 9:109511616-109511638 GAGAGGGGCCCAGCCAGGCCAGG + Intergenic
1059144935 9:111891036-111891058 GTGAGAGGATCACCTGAGCCTGG + Intergenic
1059347059 9:113636226-113636248 GGCAGGGGCTAACCAGGGCCTGG + Intergenic
1060816517 9:126638159-126638181 GAGAGGGGCTCACCTGGGCCAGG - Intronic
1060828779 9:126701070-126701092 GGAAGGGGCTGTCCTGGGCCTGG + Intergenic
1060830995 9:126716374-126716396 GAGGGAGGATCACCTGAGCCTGG + Intergenic
1061199987 9:129132421-129132443 GTGAGAGGATCACTTGGGCCCGG - Intronic
1061227275 9:129288065-129288087 GAGAGGGGCAGACCTGGCCTCGG + Intergenic
1061258183 9:129464937-129464959 GAGAGGGGCATGACTGGGCCAGG + Intergenic
1061284044 9:129612307-129612329 GCCAGGGGCACACATGGGCCAGG - Exonic
1061396873 9:130348317-130348339 GAAAGGGTGACACCTGGGCCTGG + Intronic
1061883058 9:133577621-133577643 GAGAGGGGCTGCCCCGGCCCTGG + Intergenic
1062038502 9:134393327-134393349 AGGAGGGGCACACCTGGGCCAGG - Intronic
1062055338 9:134467070-134467092 GAGATGGGGTCACCTGGTGCTGG + Intergenic
1062248898 9:135584333-135584355 GAGAAGGGCTCTCCTGGGCTTGG - Intergenic
1062322039 9:135994758-135994780 GTGGGGGGCTCAGCCGGGCCGGG - Intergenic
1062428977 9:136518542-136518564 GCAGGGGGCTCACATGGGCCAGG - Intronic
1062559505 9:137134551-137134573 GTGGGAGGCTCACCTGAGCCTGG + Intergenic
1062611007 9:137373413-137373435 CCCATGGGCTCACCTGGGCCAGG + Exonic
1062631170 9:137463808-137463830 GTGAGGGGCTCACCTGGTTCAGG - Intronic
1062682100 9:137787681-137787703 GAGAGCAGCCCGCCTGGGCCAGG + Intronic
1185549861 X:974437-974459 GAGGGAGGATCACCTGAGCCTGG - Intergenic
1185671790 X:1815908-1815930 GCGAGCGGATCACCTCGGCCAGG - Intergenic
1185864318 X:3609546-3609568 GTGAGAGGCTCGCTTGGGCCTGG - Intronic
1185870912 X:3664098-3664120 GAGAGGAGCTCAGCTGTGCAAGG - Intronic
1187130323 X:16496365-16496387 CAGAAGGGCTCACCTGGGCGGGG - Intergenic
1187315984 X:18195781-18195803 GAGGGAGGGTCACCTGAGCCCGG + Intronic
1188660488 X:32752285-32752307 GAGAGGGGTTCACGTGGTCTTGG - Intronic
1189347724 X:40254710-40254732 GTGAGAGGATCACCTGAGCCAGG - Intergenic
1190096762 X:47487602-47487624 GTGAGGGGATCACCTGAGCCTGG - Intergenic
1190102316 X:47531144-47531166 GTGAGAGGATCACCTGAGCCCGG + Intergenic
1190107367 X:47570015-47570037 GTGTGGGGCTCACCTGGTCACGG - Exonic
1190794234 X:53726061-53726083 GTGAGAGAATCACCTGGGCCCGG + Intergenic
1190973619 X:55377850-55377872 GGGAGGGGCTCTCCTGTGCATGG - Intergenic
1192497539 X:71626314-71626336 GAGAGGTGCTTTCCTGGGACCGG - Intergenic
1192745404 X:73933428-73933450 GTGGGAGGATCACCTGGGCCTGG + Intergenic
1193863357 X:86698619-86698641 TTGAGAGGCTCACCTGAGCCTGG - Intronic
1195135953 X:101907190-101907212 CACAGGGGCTCACCTGGTGCTGG - Intronic
1196834041 X:119798504-119798526 GTGGGAGGCTCACCTGAGCCTGG + Intergenic
1197005784 X:121495738-121495760 GTGAGAGGATCACCTGAGCCTGG - Intergenic
1197014540 X:121607614-121607636 GTGGGAGGATCACCTGGGCCTGG + Intergenic
1198216333 X:134558418-134558440 GAGAGGGGCTCACTTGGCCTGGG - Intergenic
1198495978 X:137193933-137193955 GAGAGGTCCTCTCCTGGTCCAGG - Intergenic
1198728107 X:139698044-139698066 GTGGGAGGCTCACCTGAGCCTGG + Intronic
1199713828 X:150491809-150491831 GAGAGAGACACAACTGGGCCAGG + Intronic
1199896594 X:152132893-152132915 GAGAGGAGTCCACCTGGGGCAGG - Intergenic
1200793170 Y:7317411-7317433 GAGAGGAGCTCAGCTGTGCAAGG + Intergenic
1200842459 Y:7796572-7796594 GAGGGGGAATCACCTGAGCCTGG - Intergenic
1202389084 Y:24351559-24351581 GAGAGAGGATCACTTGAGCCTGG - Intergenic
1202481703 Y:25318565-25318587 GAGAGAGGATCACTTGAGCCTGG + Intergenic