ID: 1060816518

View in Genome Browser
Species Human (GRCh38)
Location 9:126638164-126638186
Sequence CAGCAGAGAGGGGCTCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 8, 3: 21, 4: 261}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060816518_1060816536 20 Left 1060816518 9:126638164-126638186 CCCAGGTGAGCCCCTCTCTGCTG 0: 1
1: 0
2: 8
3: 21
4: 261
Right 1060816536 9:126638207-126638229 CCGACAGGAATGCTCCGGTGGGG No data
1060816518_1060816525 -9 Left 1060816518 9:126638164-126638186 CCCAGGTGAGCCCCTCTCTGCTG 0: 1
1: 0
2: 8
3: 21
4: 261
Right 1060816525 9:126638178-126638200 TCTCTGCTGGTGTCCCTGGCAGG No data
1060816518_1060816530 5 Left 1060816518 9:126638164-126638186 CCCAGGTGAGCCCCTCTCTGCTG 0: 1
1: 0
2: 8
3: 21
4: 261
Right 1060816530 9:126638192-126638214 CCTGGCAGGTGGGTCCCGACAGG No data
1060816518_1060816537 21 Left 1060816518 9:126638164-126638186 CCCAGGTGAGCCCCTCTCTGCTG 0: 1
1: 0
2: 8
3: 21
4: 261
Right 1060816537 9:126638208-126638230 CGACAGGAATGCTCCGGTGGGGG No data
1060816518_1060816527 -5 Left 1060816518 9:126638164-126638186 CCCAGGTGAGCCCCTCTCTGCTG 0: 1
1: 0
2: 8
3: 21
4: 261
Right 1060816527 9:126638182-126638204 TGCTGGTGTCCCTGGCAGGTGGG No data
1060816518_1060816531 15 Left 1060816518 9:126638164-126638186 CCCAGGTGAGCCCCTCTCTGCTG 0: 1
1: 0
2: 8
3: 21
4: 261
Right 1060816531 9:126638202-126638224 GGGTCCCGACAGGAATGCTCCGG No data
1060816518_1060816526 -6 Left 1060816518 9:126638164-126638186 CCCAGGTGAGCCCCTCTCTGCTG 0: 1
1: 0
2: 8
3: 21
4: 261
Right 1060816526 9:126638181-126638203 CTGCTGGTGTCCCTGGCAGGTGG No data
1060816518_1060816532 18 Left 1060816518 9:126638164-126638186 CCCAGGTGAGCCCCTCTCTGCTG 0: 1
1: 0
2: 8
3: 21
4: 261
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816518_1060816534 19 Left 1060816518 9:126638164-126638186 CCCAGGTGAGCCCCTCTCTGCTG 0: 1
1: 0
2: 8
3: 21
4: 261
Right 1060816534 9:126638206-126638228 CCCGACAGGAATGCTCCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060816518 Original CRISPR CAGCAGAGAGGGGCTCACCT GGG (reversed) Intronic
900183055 1:1320821-1320843 CACCATGCAGGGGCTCACCTCGG + Intronic
900246397 1:1638158-1638180 CAACAGAGCCGGCCTCACCTGGG + Intronic
900257626 1:1705300-1705322 CAACAGAGCCGGCCTCACCTGGG + Intronic
900539681 1:3196576-3196598 CACCAGAGAGGGGTTCAGCCAGG + Intronic
900565467 1:3329769-3329791 CTGGAGAGAGGGGCACGCCTGGG + Intronic
902467504 1:16627127-16627149 CAGCAGACAGGGACCCACCTTGG + Intergenic
902507077 1:16945602-16945624 CAGCAGACAGGGACCCACCTTGG - Exonic
903016111 1:20363165-20363187 CTGCAGAGTGGGGCAGACCTGGG - Intergenic
903790521 1:25889844-25889866 CAGCCAAGAGGGCCTCACTTAGG + Intronic
904756109 1:32769830-32769852 CAGCAGAGAGGGGATGACCAAGG - Intronic
904947014 1:34206784-34206806 CAGGAGAGAGAGGCTGCCCTGGG + Intronic
906666168 1:47623655-47623677 CAGCAGAGAGAGCCTGGCCTGGG + Intergenic
906728208 1:48059320-48059342 GAGGACAGAGGGGCCCACCTGGG - Intergenic
907947176 1:59146803-59146825 CAGCAGAGAGGGTTTCACGCGGG + Intergenic
910553031 1:88498222-88498244 CTTCAGAGAGGAGCTCACCAGGG + Intergenic
914804689 1:150983430-150983452 CGGGGGAAAGGGGCTCACCTTGG - Exonic
916057309 1:161076614-161076636 CAGCAGGGTGGGGCTGAGCTAGG - Intronic
916429035 1:164710018-164710040 CAGCAGTGAGCAGCCCACCTGGG + Intronic
917496171 1:175542066-175542088 CAGCAGTGTGGTGCTCAGCTTGG + Intronic
917929069 1:179811553-179811575 CAGCAGCGTGGGCATCACCTGGG - Intronic
920051347 1:203166782-203166804 CAGCAGAGATGGGGTCACCTAGG - Exonic
922299766 1:224287783-224287805 CATTAGAGAGGAGCTCACCATGG - Exonic
924738054 1:246777009-246777031 CAGCTGAGAGCAGCTCAGCTCGG + Intergenic
1063576575 10:7266859-7266881 GTGCAGAGAAGGGTTCACCTGGG + Intronic
1063733939 10:8731135-8731157 CAGCAGCAGTGGGCTCACCTAGG + Intergenic
1064871208 10:19938731-19938753 CTTCAGAGATGGGCTCTCCTGGG + Intronic
1067199645 10:44156162-44156184 CAGCAGATAGGGCCTCAGCTAGG - Intergenic
1067265192 10:44735662-44735684 CAGCAGACAGGGCCTCAGCTAGG - Intergenic
1067408376 10:46044038-46044060 CAGCAGCGTGGGCATCACCTGGG - Intronic
1070424329 10:76270754-76270776 CAGCCGAGAGGGGCTCAGGAAGG + Intronic
1070556176 10:77529378-77529400 CAGCAGGCAGGGGCTGAGCTGGG - Intronic
1075473054 10:122707915-122707937 CAGCAGCGTTGGGCTCATCTGGG + Intergenic
1075694368 10:124422702-124422724 CGTCAGGGAGGGTCTCACCTGGG - Intergenic
1076016820 10:127034504-127034526 CAGCAGTGCGGGGCTCAACTTGG + Intronic
1076795264 10:132795146-132795168 CAGCCGAGGGGCGCTCCCCTCGG + Intergenic
1076887925 10:133271077-133271099 CAGCAGAGAACAGCTCACCATGG + Intronic
1076893618 10:133297723-133297745 CAGCAGAGAACGGCTCACCCGGG - Intronic
1077151288 11:1074250-1074272 CTGCAGAGAAGGGCTCAGCCTGG + Intergenic
1077191963 11:1259347-1259369 CAGCAGCTGTGGGCTCACCTGGG - Intronic
1077552703 11:3208320-3208342 CAGTAGAGAAGGGCTCACGGGGG + Intergenic
1082796944 11:57384857-57384879 AGGCAGAGAGGGGCTGACCCTGG - Intergenic
1083486069 11:62983752-62983774 CAGGAGAGGAGGGCTCACCCTGG + Intronic
1084062540 11:66685687-66685709 CAGAAGAGAAGGGCTGCCCTTGG + Exonic
1084171994 11:67405304-67405326 CAGCAGGCAGGGGCCCACTTTGG - Intronic
1084352691 11:68614742-68614764 CTTCAGAGAGGGGCTCACCCGGG - Exonic
1084393956 11:68896792-68896814 CAGCAGTGAGGTGCTCACAAGGG - Intronic
1085476982 11:76795104-76795126 CAGCAGAGAGTGGGGCACCCTGG + Intronic
1089254871 11:117188926-117188948 CAGAAGGAAGGGGCTCAGCTGGG + Intronic
1091211588 11:133865248-133865270 CCGCAGAGAGGGGCGGACATCGG - Intergenic
1091582907 12:1799644-1799666 CAGCAGGGATGGCCTCAGCTGGG + Intronic
1091602921 12:1928837-1928859 CAGGAGAGAAGGGCCCTCCTCGG + Intergenic
1092155025 12:6276597-6276619 GAGCAGAGCAGGGCTGACCTGGG - Intergenic
1092727858 12:11501661-11501683 CAGCCAAGAGGGGCTCATTTGGG + Intergenic
1092727861 12:11501703-11501725 CAGAAGAAAGGTGCTCACTTGGG - Intergenic
1094064964 12:26352304-26352326 CAGCACAGAGGGCATCACCACGG - Intronic
1095403308 12:41839817-41839839 AGCCAGAGAGGGGCTCCCCTTGG + Intergenic
1096129535 12:49146784-49146806 CACCATGGAGGGGTTCACCTTGG + Intergenic
1097938648 12:65279382-65279404 CGGCAGGGAGGGGCGCACCCGGG + Intronic
1100726692 12:97416619-97416641 CAGCAGCGCTGGCCTCACCTAGG + Intergenic
1101404141 12:104413181-104413203 CAGCTGGGAGGGGCTCACCTGGG - Intergenic
1104083826 12:125456995-125457017 CAGCAGGGAGGGGAGGACCTCGG - Intronic
1104635806 12:130437324-130437346 CAGGACCGCGGGGCTCACCTCGG - Intronic
1104965664 12:132507826-132507848 CAGCAGGGAGGGGCAGTCCTGGG + Intronic
1110238876 13:73244948-73244970 CAGCACAGAGAACCTCACCTGGG + Intergenic
1112116580 13:96361923-96361945 CAGCAGATTTGGGATCACCTGGG + Intronic
1113119358 13:106909793-106909815 GGGCACAGAGGGGCTCACCAGGG - Intergenic
1113455478 13:110445878-110445900 CATGAGAAACGGGCTCACCTTGG - Exonic
1113461059 13:110482513-110482535 AAGGAGATAGAGGCTCACCTGGG + Exonic
1113672793 13:112186250-112186272 CTGCAGAGACGGGCTCTCCATGG + Intergenic
1114063101 14:19037900-19037922 CGGCGGGGAGGGGGTCACCTCGG + Intergenic
1114099157 14:19362095-19362117 CGGCGGGGAGGGGGTCACCTCGG - Intergenic
1116177351 14:41488945-41488967 CAGCAGAGAGATTCTAACCTGGG - Intergenic
1117420548 14:55540554-55540576 CAGTACAGTGTGGCTCACCTGGG - Intergenic
1121105657 14:91277963-91277985 CAGCAGTGAGATGGTCACCTTGG - Exonic
1121534241 14:94680255-94680277 CAGCCCTGAGGGGCTCACATGGG - Intergenic
1122857651 14:104567515-104567537 CAGCAGGGAGGGGCCCTCCGGGG + Intronic
1122858531 14:104571749-104571771 CAGCAGTGATGGGCTCACGACGG - Intronic
1122858959 14:104573730-104573752 CACCAGTGACGGGCACACCTGGG + Intronic
1122906589 14:104804526-104804548 CAGCAGCGTGGGGGTCTCCTGGG + Exonic
1123037754 14:105478356-105478378 CCGCGCAGTGGGGCTCACCTCGG - Exonic
1123147802 14:106150821-106150843 CTGCAGGGAGGGGCCCACATGGG + Intergenic
1126356570 15:47802301-47802323 CAACAGTGTTGGGCTCACCTGGG + Intergenic
1128552770 15:68609000-68609022 CAGCAGAGAGGAAATCAACTTGG + Intronic
1129203407 15:74020241-74020263 CAGAAGAAAGGGTCTCATCTGGG - Intronic
1129338553 15:74869578-74869600 CAGCAGGAAGGTGCTGACCTGGG - Intronic
1130985490 15:88842154-88842176 CAGCAGCCAGGGTCTCAGCTGGG - Intronic
1131370466 15:91876795-91876817 CAGCAGAGAAGAGCGCACCAGGG - Intronic
1132222750 15:100117125-100117147 CAGCAGAGAGGGGGTGGCTTTGG - Intronic
1132740323 16:1408750-1408772 CAGCAGCGGGGGGCCCTCCTGGG + Intronic
1132762928 16:1519764-1519786 CAGCAGATGGGAGCTCACTTGGG - Intronic
1133063148 16:3188475-3188497 AAGCGGAGGAGGGCTCACCTGGG - Intergenic
1133439397 16:5807826-5807848 CAGCAGCGTGGGCATCACCTGGG - Intergenic
1133885701 16:9825726-9825748 GAGCAGAGAGAGGATCAGCTGGG + Intronic
1135511587 16:23089226-23089248 CAGCACACTGGGGCTCAGCTTGG + Intronic
1136560798 16:31038199-31038221 CAGCAGAGAGGGGCTGGCTGTGG - Intronic
1136690945 16:32028618-32028640 CTGCAGGGAGGGGCCCACATGGG - Intergenic
1136791532 16:32972180-32972202 CTGCAGGGAGGGGCCCACATGGG - Intergenic
1136878282 16:33881752-33881774 CTGCAGGGAGGGGCCCACATGGG + Intergenic
1138351304 16:56347613-56347635 CATGAGAGAGGGGCTCCCCCTGG + Exonic
1138396051 16:56705555-56705577 CAGCAGGGAGGGCCTGCCCTGGG + Intronic
1138480154 16:57297385-57297407 AAGCAGAGAGGGGCACAGGTGGG + Intergenic
1139573533 16:67827673-67827695 CAGCACAGAGGAGGGCACCTGGG + Intronic
1140454548 16:75097382-75097404 CAGCTGAGGGGAGCTCTCCTTGG - Intronic
1140876040 16:79153363-79153385 CAGCAGAGGAGGGCTCTGCTTGG - Intronic
1141193499 16:81842215-81842237 CTGCAGACTGGAGCTCACCTGGG - Intronic
1203093741 16_KI270728v1_random:1233641-1233663 CTGCAGGGAGGGGCCCACATGGG - Intergenic
1143020973 17:3917060-3917082 CAGCCGAGAGAGCCTGACCTCGG + Intergenic
1144782037 17:17813306-17813328 CAGCAGGGAAGGGCGCACATGGG - Intronic
1145004245 17:19328543-19328565 CAGCAAAGAGGGACACAGCTGGG - Intronic
1145828929 17:27899159-27899181 CAGCAGCCTGGGCCTCACCTGGG + Intergenic
1146465983 17:33087103-33087125 CAGTACTGAGGAGCTCACCTAGG + Intronic
1147166009 17:38593804-38593826 CAACAGTGAGGGGCTGACCCCGG + Intronic
1148467483 17:47873637-47873659 ACGCAGGGAGGGGCTCAACTCGG - Intergenic
1150641555 17:66953141-66953163 TCCCAGAGAGGGGCTCAGCTGGG - Intergenic
1151548617 17:74808452-74808474 CTGCAGGGAGGAGCTCTCCTTGG + Intronic
1151869253 17:76825474-76825496 CAGGAGAGAGAGGCTGCCCTAGG - Intergenic
1152139290 17:78526821-78526843 GAGCAGCGTGGGGCTCACCCAGG - Intronic
1152251216 17:79213556-79213578 CAGGAGAGTGGGGCTGACCCTGG - Intronic
1152572716 17:81127604-81127626 CAGCAGGTAGGGCGTCACCTCGG + Exonic
1152587830 17:81196990-81197012 CATCACAGACGTGCTCACCTCGG + Exonic
1152905351 17:82967468-82967490 CAGCACAGTGGCCCTCACCTGGG + Intronic
1153626829 18:7029255-7029277 CAGCAGTGTGGGCATCACCTGGG - Intronic
1157046273 18:44104822-44104844 CAGCTAAGAGGGGGTCATCTAGG + Intergenic
1157794173 18:50559839-50559861 CCGCGGAGACGAGCTCACCTGGG - Intergenic
1160015073 18:75134013-75134035 CAGCACAGAGGGGCTTCACTTGG + Intergenic
1161036527 19:2088046-2088068 CTGCAGTGGGGGTCTCACCTGGG + Intronic
1161489691 19:4555193-4555215 CTGGAGACAGGGGCTCCCCTAGG - Intronic
1162111729 19:8403338-8403360 CTGCAGGGAGGGGTTCCCCTCGG + Intronic
1162472393 19:10880246-10880268 CAGGATGGAGGGGCCCACCTGGG + Intronic
1163651577 19:18521230-18521252 CCGGAGAGAGAGGGTCACCTGGG + Intronic
1163672609 19:18637463-18637485 CAGCAGAGAGGGCCTGAGCAGGG + Intronic
1163798358 19:19349882-19349904 CACCAGAGACTGGCTGACCTTGG - Intronic
1165091110 19:33388851-33388873 CAGCTGAGGGGGCCTCAGCTTGG + Intronic
1165858227 19:38893054-38893076 CAGCAGAGATTGGCTCCCATTGG - Intronic
1166834309 19:45657952-45657974 CAGCAGAGGGGCTCTCAGCTGGG - Intergenic
1167208968 19:48121362-48121384 CAGCAGTGAGGGCCCCGCCTTGG - Intronic
925646427 2:6041996-6042018 CTTCAGAGAGGTGCTCTCCTGGG + Intergenic
926004780 2:9365326-9365348 CATCAGGGAGGAGCTGACCTTGG + Intronic
926098291 2:10096939-10096961 GAGCAGAGAGGGGCTCCACAGGG + Intergenic
926218446 2:10919808-10919830 CAGCAGAATGGGTCTGACCTTGG + Intergenic
926305562 2:11635401-11635423 CAGCAGCGAGGAGCTCACCTTGG - Exonic
927073405 2:19552345-19552367 CTTCTGAGAGGGGCCCACCTGGG - Intergenic
927644777 2:24870676-24870698 CAGCAGAGAGGGTCATCCCTGGG - Intronic
927888298 2:26731812-26731834 CAGCAGTGAGTGGCAGACCTAGG + Exonic
933645603 2:84810503-84810525 CAGAAGGGAGGTGCTCACCACGG + Intronic
934236480 2:90237675-90237697 CAGCGTAGGGGGGCCCACCTTGG - Intergenic
934972366 2:98773815-98773837 CAGCAGAGAAGGACTGCCCTGGG + Intergenic
937293012 2:120793393-120793415 CAGCAGGGAGGGTCTCTCCAGGG - Intronic
938792727 2:134691115-134691137 CAGCAGTGAGGGCCTCAGCAGGG + Intronic
941155494 2:161972809-161972831 CAGCAGAGAGGGGCTTTCCTTGG + Intronic
945644056 2:212467429-212467451 CAGCTGAAAGGGGCCAACCTGGG - Intronic
946325102 2:218981011-218981033 AAGCAGGGAGAGGCTCATCTCGG - Intergenic
947938564 2:234028081-234028103 AAGCAGAGAGGGGCTCAGATAGG - Intergenic
948060950 2:235042967-235042989 CAGCACCGAGGTGCTCAGCTCGG - Exonic
948886484 2:240887617-240887639 CAGCAGAGGGTGGCTACCCTGGG + Intronic
1168893073 20:1306934-1306956 CAGATGAGATGGCCTCACCTTGG - Exonic
1171151034 20:22826678-22826700 CCTCAGAGAGGGGCCCTCCTGGG + Intergenic
1171170970 20:23015115-23015137 CAGCCCAGACGGTCTCACCTGGG - Intergenic
1172023803 20:31934527-31934549 CCTCAAAGAGGGGCACACCTGGG + Intronic
1172435680 20:34927404-34927426 CAGCAGACTGAGGCTGACCTGGG - Exonic
1172521774 20:35571556-35571578 CAGCTGGGAGGAGCTCTCCTGGG + Intergenic
1173248560 20:41352520-41352542 CAGCAGAGTGGGGAGCACCAGGG + Intronic
1173341181 20:42154316-42154338 GAGCAGAGAAGGGAGCACCTGGG + Intronic
1174452307 20:50627968-50627990 CAGCTGGGAGAGGGTCACCTGGG + Intronic
1174677646 20:52373930-52373952 CAGCTGCAATGGGCTCACCTGGG - Intergenic
1174759434 20:53192641-53192663 CAGGACAGAAGGGCTCTCCTGGG + Intronic
1175192876 20:57223328-57223350 CAGCACACAGGGAATCACCTGGG + Intronic
1175769072 20:61611527-61611549 CAGCAAAGAGGTGCTCACACAGG - Intronic
1176051060 20:63119992-63120014 CACCAGTGAGGGGATCACCAGGG + Intergenic
1176261033 20:64180489-64180511 CTGCAGAGAGGGGCTCAGCAAGG - Intronic
1176312693 21:5161659-5161681 CAGCAGAGAAGGGCTCAGGGAGG + Intergenic
1177047202 21:16185178-16185200 CAGGGGAGAGGGACTCAACTGGG + Intergenic
1178441644 21:32603347-32603369 CTGCTGGGAGGGGCTCAGCTGGG - Intronic
1179844355 21:44100371-44100393 CAGCAGAGAAGGGCTCAGGGAGG - Intronic
1180481594 22:15760529-15760551 CGGCGGGGAGGGGGTCACCTCGG + Intergenic
1180784636 22:18539979-18540001 CAGCAGTCCTGGGCTCACCTTGG - Intergenic
1181241539 22:21479336-21479358 CAGCAGTCCTGGGCTCACCTTGG - Intergenic
1181456299 22:23061960-23061982 GAACAGAGAGGGGCTCTGCTTGG + Intronic
1182104408 22:27679081-27679103 CAGCAGAGAGGGCAGCTCCTGGG - Intergenic
1182259556 22:29063479-29063501 CAGCAGAGAGCTGTTCACATGGG + Intergenic
1182588923 22:31364053-31364075 CGGCAGAGAAGGGCCCACTTGGG - Intergenic
1182902680 22:33911395-33911417 CAGCAGAGAGGGAGTCATATTGG + Intronic
1183391074 22:37545998-37546020 CAGCAGATGGGGGCTGACCCGGG + Intergenic
1183750215 22:39715838-39715860 CAGCAGGCAGGGGCCCAGCTGGG + Intergenic
1184318884 22:43723741-43723763 CAGCACACTGGGGCTCACGTGGG - Intronic
1184896914 22:47414230-47414252 CAGAAGTGGGAGGCTCACCTGGG + Intergenic
1184921445 22:47608467-47608489 CAGCAGAGGGGAGCCCTCCTTGG + Intergenic
1184978198 22:48078089-48078111 CAGCAGGGCGGGGCTCTCCCTGG + Intergenic
1185148665 22:49152397-49152419 CTGCTGAGAGGGGCTGGCCTGGG - Intergenic
1185151553 22:49166901-49166923 GAGCAGGAAGGGGCTCCCCTCGG - Intergenic
1185266482 22:49906817-49906839 CAGCAGTGATGGACTCTCCTGGG + Intronic
950256465 3:11510606-11510628 CAGCTGGGAGAGGCTCGCCTTGG + Intronic
950444908 3:13031355-13031377 CAGCAGGGAGGGGCTCAGCTGGG + Intronic
950509273 3:13415993-13416015 CAGCAAAGAGGGACTCCCCAGGG + Intronic
951589773 3:24251182-24251204 CAGCATTGAGGGTCTCACATAGG - Intronic
953079968 3:39608032-39608054 CAGCAGATTGGGGCTGACCTAGG - Intergenic
954618811 3:51984241-51984263 CAGCAGAGTGGGGCTCAGCTGGG - Intronic
955756943 3:62234426-62234448 CTGCAGAGAGAAGCCCACCTTGG - Intronic
955872408 3:63453023-63453045 CAGCAGCGTGGGCATCACCTGGG + Intronic
957426886 3:80051172-80051194 CAGCAGAGAGGGGTCCAGCGAGG + Intergenic
961009276 3:123425095-123425117 CTGCAGAGAGGGGCCCATCCTGG + Intronic
961748976 3:129084633-129084655 CAGCAGCGTGGGTATCACCTAGG - Intergenic
961941447 3:130641668-130641690 CAGGAGAGATGGGATCCCCTGGG + Exonic
964296567 3:155240144-155240166 CAGCAGACAGGGGTGCACTTAGG + Intergenic
968008277 3:195257392-195257414 CAGGGGAAAGGGGCTCACCAGGG + Intronic
968668520 4:1834746-1834768 CAGCAGAGTGGAGCTCCCCCAGG - Intronic
968794665 4:2694770-2694792 AAGCAGCAAGGGGCTCACGTGGG - Intronic
969514544 4:7639058-7639080 CTGCAGGGAGGGGCCCACCTGGG + Intronic
970425358 4:15940840-15940862 CAACAGAGAGGGGCTCGCATTGG - Intergenic
970463924 4:16304357-16304379 CAACAGAGAGGGGCTCGCATTGG + Intergenic
971683257 4:29729820-29729842 CAGTAGAGAGAGTCTCACTTTGG + Intergenic
973345525 4:49050845-49050867 CAGCATAAAGGAACTCACCTGGG - Exonic
975026009 4:69549822-69549844 GAGCAGAGAGGAGCAAACCTGGG + Intergenic
975962126 4:79923498-79923520 CATCGGAGAGGAGCTGACCTTGG + Intronic
978636049 4:110808703-110808725 CACCAGTGACTGGCTCACCTTGG + Intergenic
981031266 4:140128083-140128105 CAGCAGAAGGGGCCTCACCAGGG - Intronic
981755051 4:148133769-148133791 CAGCAGAGAGTGGCTCACATGGG + Intronic
982737891 4:159025132-159025154 CAGCAGGGTGGGCATCACCTGGG + Intronic
983004050 4:162460506-162460528 CAGCAGAGAGGGGAACACCTGGG - Intergenic
985783250 5:1881684-1881706 CAGAGGGGAGGCGCTCACCTTGG - Intronic
992382473 5:76251664-76251686 CAGCAGAGTGAGTATCACCTGGG - Intronic
994719976 5:103369394-103369416 TAACAGAGAGGAGCTCTCCTGGG - Intergenic
995246308 5:109939309-109939331 CTGCAGAGAGTGACTCACTTGGG - Intergenic
995584913 5:113638562-113638584 CAACAGAGAGGGCCTCAGTTTGG + Intergenic
997449316 5:133968818-133968840 CGGCAGGGAGGGGCTCGCTTTGG - Intergenic
997588160 5:135056584-135056606 CAGTAGAGATGGGATGACCTAGG - Intronic
997631505 5:135372516-135372538 CAGCAGTGATGGGCCCACCTTGG + Intronic
999254294 5:150201219-150201241 CCGCCCTGAGGGGCTCACCTTGG - Exonic
1000799962 5:165713523-165713545 CAGCAGAGAGCTGCCCACCATGG - Intergenic
1002712626 5:181204465-181204487 AAGAAGGGAGGGGCTCACCCGGG + Intronic
1005963829 6:30712421-30712443 AAGCAGATAAGAGCTCACCTGGG - Exonic
1007298352 6:40846064-40846086 GAACAGAGAGGTGCTCATCTGGG - Intergenic
1007392083 6:41555380-41555402 TATCATAGAGGGGCTCACCCTGG - Intronic
1007634097 6:43287629-43287651 CAGTGGGGAGGGGGTCACCTAGG + Exonic
1009536215 6:64890056-64890078 CATAAGAGATGGGCACACCTTGG - Intronic
1009972546 6:70640304-70640326 AAGCACAGAAGGGCTGACCTGGG + Intergenic
1012755659 6:103227245-103227267 CAGCAGAGAAGCTCTCACCAAGG - Intergenic
1012865029 6:104608849-104608871 CAGCAGTGAGGAGCTTGCCTGGG - Intergenic
1013115242 6:107098533-107098555 CAGCAGCTAGGCCCTCACCTCGG + Exonic
1015431276 6:133132558-133132580 TAGCAGAGAGGGTCTCTGCTGGG + Intergenic
1015836049 6:137421246-137421268 CAGCAGACAGGATCTGACCTAGG + Intergenic
1017776339 6:157683909-157683931 CAGCTGACAGGGCCTCACCGTGG - Intergenic
1018887446 6:167951875-167951897 CAGCAAAGAGGAGCTTTCCTCGG + Exonic
1019390552 7:784234-784256 GAGCAGTGAGGGGCCCACATGGG - Intronic
1019876014 7:3811602-3811624 CAGCAGAGAGGGGCTTTGGTGGG - Intronic
1020387769 7:7626495-7626517 CATAAGAGACGGGCACACCTAGG + Intergenic
1020812570 7:12864572-12864594 AGGCAGAGAGGGGCCCAGCTAGG - Intergenic
1021508972 7:21414683-21414705 CAGCAGAGATGGGGTCACTTGGG - Intergenic
1024895717 7:54259439-54259461 CTGGAGAGAGGGCGTCACCTTGG + Intergenic
1024951384 7:54864233-54864255 CAGGAGTGACGGGCTCACCATGG - Intergenic
1025709533 7:63894190-63894212 CAGAAGATAGAAGCTCACCTGGG + Intergenic
1028889373 7:95969984-95970006 AAGCGTAGAGGCGCTCACCTTGG + Intronic
1030073944 7:105720843-105720865 CAGCAGAGCTGAGCACACCTTGG + Intronic
1032997974 7:137469566-137469588 CAGCACAGAGGCTCTCTCCTCGG - Exonic
1034338825 7:150339817-150339839 CATCAGAGCAGGGCTCACCTCGG - Intronic
1034470800 7:151253399-151253421 CAGCAGGGTGGGCCTTACCTTGG + Intronic
1034520570 7:151616214-151616236 CACCAGAGAGAGGCTCTGCTTGG + Intronic
1034583862 7:152071266-152071288 CATAAGAGACGGGCACACCTGGG + Intronic
1035152539 7:156886614-156886636 CAGGAGAGTGGGGATCACTTAGG + Intronic
1035236317 7:157499751-157499773 GAGCAGAGGAGGGCTCCCCTGGG + Intergenic
1037898914 8:22676167-22676189 CAGCAGAGGGGCCCTCCCCTGGG + Intergenic
1043358018 8:79436626-79436648 CAGTAGAAAAAGGCTCACCTAGG + Intergenic
1044730288 8:95223780-95223802 CAGAAGAGAGGAGCTCACTTTGG - Intergenic
1044859750 8:96511342-96511364 CAGCAGTGTGGGCATCACCTGGG + Intronic
1044881535 8:96728053-96728075 CCAGAGAGAGGGGCACACCTTGG - Intronic
1046037032 8:108854880-108854902 CAGCTGAGAGGAGCTCTCCTGGG + Intergenic
1048061058 8:130919668-130919690 AAACAGACAGGGGCTGACCTAGG + Intronic
1049398035 8:142410969-142410991 AAGCAGAGAGGGGCACTGCTGGG - Intergenic
1049470503 8:142773207-142773229 CAGCTGAGAGGGCCTCATTTGGG + Intronic
1049853902 8:144849752-144849774 CAGCAGAGAGGCTGTCACCAGGG - Intronic
1051549927 9:18316404-18316426 CATAAGAGACGGGCACACCTGGG + Intergenic
1054786349 9:69213942-69213964 CAGCATAGTGGGCCTCACGTGGG + Intronic
1055610831 9:78022188-78022210 CAGCAGTGATGGGCTCTACTAGG - Intronic
1055963606 9:81843976-81843998 GAGCAGAGAAGGGCTCAGCCAGG + Intergenic
1056498923 9:87189026-87189048 CAGGTGAGAGGGGCCCAGCTCGG - Intergenic
1058265187 9:102890237-102890259 CATAAGAGATGGGCACACCTGGG - Intergenic
1058890566 9:109357249-109357271 CTGCAGAGAGGGGCTAAACAAGG - Intergenic
1059297791 9:113287623-113287645 CACCAGACAGGGTCTCACTTAGG + Intronic
1060816518 9:126638164-126638186 CAGCAGAGAGGGGCTCACCTGGG - Intronic
1061352028 9:130073060-130073082 CAGGAGAAAGGGGCTTTCCTGGG - Intronic
1061365486 9:130170850-130170872 CAGCAGTGAGGGGCCCACAGTGG - Intergenic
1062142555 9:134967582-134967604 GCGCAGATAGGGGGTCACCTCGG - Intergenic
1062214636 9:135382604-135382626 GGGCAGAGAGGGGCTCAGCCTGG - Intergenic
1062248899 9:135584338-135584360 GAGCAGAGAAGGGCTCTCCTGGG - Intergenic
1062394897 9:136348851-136348873 CAGCAGACAGGGGCTGAGGTGGG - Intronic
1190774944 X:53545087-53545109 CAGGAGAGAGGGTTTCACATTGG + Exonic
1191964813 X:66746423-66746445 GAGCAGAGAGGGGCTCAGTAGGG - Intergenic
1192078753 X:68026867-68026889 CTGAAGAGAGGGGCTCACTCTGG - Intergenic
1192220623 X:69195263-69195285 CAGCAGGGAGGGCCACAGCTGGG - Intergenic
1199725676 X:150578158-150578180 CAGCAAAGAGAATCTCACCTCGG - Intronic
1201517405 Y:14833008-14833030 CATAAGAGATGGGCTCACCTAGG + Intronic