ID: 1060816519

View in Genome Browser
Species Human (GRCh38)
Location 9:126638165-126638187
Sequence CCAGCAGAGAGGGGCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 286}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060816519_1060816532 17 Left 1060816519 9:126638165-126638187 CCAGGTGAGCCCCTCTCTGCTGG 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816519_1060816536 19 Left 1060816519 9:126638165-126638187 CCAGGTGAGCCCCTCTCTGCTGG 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1060816536 9:126638207-126638229 CCGACAGGAATGCTCCGGTGGGG No data
1060816519_1060816527 -6 Left 1060816519 9:126638165-126638187 CCAGGTGAGCCCCTCTCTGCTGG 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1060816527 9:126638182-126638204 TGCTGGTGTCCCTGGCAGGTGGG No data
1060816519_1060816537 20 Left 1060816519 9:126638165-126638187 CCAGGTGAGCCCCTCTCTGCTGG 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1060816537 9:126638208-126638230 CGACAGGAATGCTCCGGTGGGGG No data
1060816519_1060816534 18 Left 1060816519 9:126638165-126638187 CCAGGTGAGCCCCTCTCTGCTGG 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1060816534 9:126638206-126638228 CCCGACAGGAATGCTCCGGTGGG No data
1060816519_1060816526 -7 Left 1060816519 9:126638165-126638187 CCAGGTGAGCCCCTCTCTGCTGG 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1060816526 9:126638181-126638203 CTGCTGGTGTCCCTGGCAGGTGG No data
1060816519_1060816530 4 Left 1060816519 9:126638165-126638187 CCAGGTGAGCCCCTCTCTGCTGG 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1060816530 9:126638192-126638214 CCTGGCAGGTGGGTCCCGACAGG No data
1060816519_1060816525 -10 Left 1060816519 9:126638165-126638187 CCAGGTGAGCCCCTCTCTGCTGG 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1060816525 9:126638178-126638200 TCTCTGCTGGTGTCCCTGGCAGG No data
1060816519_1060816531 14 Left 1060816519 9:126638165-126638187 CCAGGTGAGCCCCTCTCTGCTGG 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1060816531 9:126638202-126638224 GGGTCCCGACAGGAATGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060816519 Original CRISPR CCAGCAGAGAGGGGCTCACC TGG (reversed) Intronic
900246396 1:1638157-1638179 CCAACAGAGCCGGCCTCACCTGG + Intronic
900257625 1:1705299-1705321 CCAACAGAGCCGGCCTCACCTGG + Intronic
900526090 1:3129553-3129575 CCAGCAGGGAGGGTCTGCCCCGG - Intronic
900766293 1:4508051-4508073 ACCGCAGAGAGGGGCTCAAAAGG - Intergenic
901067640 1:6502035-6502057 CCAGGAGGGTGGGGCTCACGCGG - Intronic
902116957 1:14129124-14129146 CCAGCACATAGGGACTCACATGG + Intergenic
902563872 1:17297031-17297053 TCAGCAGAGGGGTGCTCAGCAGG + Intergenic
902623589 1:17664358-17664380 CCAGCAGCAGGGGGCTCAGCAGG - Intronic
902810272 1:18884196-18884218 CCAGCAACGTGCGGCTCACCAGG + Intronic
903188657 1:21643938-21643960 CCAGGAGATAGGGGCACACAGGG + Intronic
903480204 1:23647457-23647479 CCTGCAGATAGGAGCCCACCTGG + Intergenic
906223947 1:44105799-44105821 CCAGCAGCAAGGACCTCACCAGG - Intergenic
907947175 1:59146802-59146824 GCAGCAGAGAGGGTTTCACGCGG + Intergenic
909776227 1:79488793-79488815 CCGGCAGAGTGGGGGTCACAAGG + Intergenic
910229434 1:84970712-84970734 CCAGCAGAGCATGGCTCACAAGG - Intronic
910553030 1:88498221-88498243 TCTTCAGAGAGGAGCTCACCAGG + Intergenic
912390676 1:109300480-109300502 TCAGCAGGGCGGGGCTCAGCGGG - Intronic
912413819 1:109494903-109494925 CCAGCTGAGAGGTGCTGAACGGG + Intronic
913284087 1:117211274-117211296 CCAGCAGAGATGGGGACTCCTGG - Intergenic
915230377 1:154441506-154441528 TCAGCAGAGAGGGGAGCAGCAGG - Intronic
915621944 1:157091542-157091564 CCAACAGAGAGGGGTGCCCCAGG - Intergenic
916787647 1:168098067-168098089 CCAGCACAGAGGGTCACAGCAGG + Intronic
917929070 1:179811554-179811576 CCAGCAGCGTGGGCATCACCTGG - Intronic
918117221 1:181507890-181507912 ACAACAGTGTGGGGCTCACCTGG - Intronic
919627474 1:199925738-199925760 CCAACAGTCAGGGGCTCACAGGG + Intergenic
924638343 1:245809742-245809764 CCAGCACAGAGGAGCTTCCCAGG + Intronic
1065989953 10:30999319-30999341 CCAGAGGAGTGGGCCTCACCAGG + Intronic
1066442883 10:35455442-35455464 CCAGCATAGGGAGGCTCAGCAGG + Intronic
1067408377 10:46044039-46044061 CCAGCAGCGTGGGCATCACCTGG - Intronic
1067703559 10:48590487-48590509 CCAGCAGGTAGGGCCTCAGCTGG - Intronic
1068973653 10:62985077-62985099 CCATCAGAGAGGAGCTCATTGGG - Intergenic
1069060770 10:63892208-63892230 CCAAGAGAGAGGGGTTCTCCAGG + Intergenic
1069751849 10:70749982-70750004 CGCACAGAGTGGGGCTCACCAGG - Exonic
1070320877 10:75353642-75353664 CAAGAAGGGAGGGGCTCCCCTGG + Intergenic
1070762107 10:79030310-79030332 CCAGCAGAGAGGGGCCCAGGGGG - Intergenic
1075473053 10:122707914-122707936 CCAGCAGCGTTGGGCTCATCTGG + Intergenic
1076735233 10:132456014-132456036 CCTACAGAGAGGGGCTGGCCTGG - Intergenic
1076767430 10:132644230-132644252 CCAGGAGGGAGGGGCCCACTCGG + Intronic
1076893619 10:133297724-133297746 GCAGCAGAGAACGGCTCACCCGG - Intronic
1077138496 11:1013223-1013245 CCAGCAGAGAGGGACTGAGGCGG - Exonic
1077191964 11:1259348-1259370 CCAGCAGCTGTGGGCTCACCTGG - Intronic
1077253334 11:1570317-1570339 CCGGCAGAGGGGGCCTCAGCGGG + Intronic
1077310860 11:1888534-1888556 CAGGCAGGGAGGGGCTCATCAGG - Intronic
1077402812 11:2367445-2367467 TCAGCAGAGGGGAGCCCACCCGG - Intergenic
1077539655 11:3140543-3140565 CCAGCAGAGAGGGGCACCGAGGG + Intronic
1077552702 11:3208319-3208341 ACAGTAGAGAAGGGCTCACGGGG + Intergenic
1083106211 11:60360899-60360921 TCAGCAGAGAGGGGGTTACAAGG + Intronic
1084352692 11:68614743-68614765 TCTTCAGAGAGGGGCTCACCCGG - Exonic
1084393957 11:68896793-68896815 CCAGCAGTGAGGTGCTCACAAGG - Intronic
1084653633 11:70502856-70502878 CCGGCAGGGAGGGAATCACCTGG - Exonic
1088579441 11:111300582-111300604 GCAGCAAAGACGGGCACACCAGG + Exonic
1091582906 12:1799643-1799665 CCAGCAGGGATGGCCTCAGCTGG + Intronic
1091749285 12:3012479-3012501 CCTGCTTAGAGGGGCTCACACGG + Intronic
1097154989 12:57006186-57006208 CAAACAGCGCGGGGCTCACCCGG + Intronic
1097938647 12:65279381-65279403 GCGGCAGGGAGGGGCGCACCCGG + Intronic
1101404142 12:104413182-104413204 GCAGCTGGGAGGGGCTCACCTGG - Intergenic
1103500851 12:121400476-121400498 GGCGCAGAGAGGGGCCCACCCGG - Intronic
1103836394 12:123824464-123824486 CCAGTTCAGATGGGCTCACCTGG + Intronic
1104355924 12:128087187-128087209 CCAGCAGGTTGGGGCTCACCCGG + Intergenic
1104409281 12:128544329-128544351 AGAGCAGAGATGAGCTCACCCGG - Intronic
1104523362 12:129495843-129495865 ACAGCAGAGTGGGACACACCTGG - Intronic
1104588716 12:130067674-130067696 CCAGCAGGAAGGACCTCACCAGG - Intergenic
1105631499 13:22174084-22174106 CCAGCATACATGGGCACACCTGG - Intergenic
1106607360 13:31241463-31241485 CCAGCAGGGATGGCCTCTCCAGG + Intronic
1108020921 13:46127040-46127062 CCAGAAGAGATGGGCCCCCCCGG + Exonic
1109343265 13:61088660-61088682 CGGGCAGAGTGGGGCTCACAAGG - Intergenic
1110238875 13:73244947-73244969 CCAGCACAGAGAACCTCACCTGG + Intergenic
1112116579 13:96361922-96361944 CCAGCAGATTTGGGATCACCTGG + Intronic
1112832201 13:103466914-103466936 CCTGCTGAGAGGTGCTCACCAGG - Intergenic
1113119359 13:106909794-106909816 AGGGCACAGAGGGGCTCACCAGG - Intergenic
1113185689 13:107683735-107683757 CCAGGAGAGAGGAGCCCAGCAGG - Intronic
1113435929 13:110290994-110291016 CCAGCACAGAGGTGCTCACAGGG + Intronic
1114648048 14:24266605-24266627 AGAGCACAGAGGGGCTCACAGGG + Intronic
1115363827 14:32533798-32533820 CCAGCAGAGACGAGCTAATCTGG + Intronic
1116535123 14:46017879-46017901 CGAGCAGAGTGGGGGTCACAAGG + Intergenic
1117189733 14:53278193-53278215 CAGGCAGAGAGGGGCTCCCCTGG + Intergenic
1117420549 14:55540555-55540577 CCAGTACAGTGTGGCTCACCTGG - Intergenic
1118503272 14:66383595-66383617 CAAGCAGAGAGAGGCTGACTGGG + Intergenic
1118616858 14:67579896-67579918 TGAGCAGGGAGGGGCTCAGCTGG - Intronic
1119035195 14:71223825-71223847 CCTGCAGAGAGGGGCACTGCAGG + Intergenic
1120852908 14:89187141-89187163 CCAGCAGATAGAGGCTGGCCTGG - Intronic
1122364752 14:101187998-101188020 ACAGCAGAGAGGGGTGCCCCTGG + Intergenic
1122857650 14:104567514-104567536 GCAGCAGGGAGGGGCCCTCCGGG + Intronic
1124101950 15:26703858-26703880 CCAGCAAAGTGGGGCTGCCCAGG - Intronic
1125725467 15:41866211-41866233 CCAGAAGGGAGAGGCTCTCCTGG - Exonic
1125769244 15:42154073-42154095 CCAGCACTGGTGGGCTCACCTGG + Exonic
1126356569 15:47802300-47802322 CCAACAGTGTTGGGCTCACCTGG + Intergenic
1127594017 15:60459838-60459860 CCAACAGAGAGGGGGACACTAGG + Intronic
1129203408 15:74020242-74020264 CCAGAAGAAAGGGTCTCATCTGG - Intronic
1131271352 15:90949422-90949444 CCTGCAGAGAGCTGCTCTCCAGG + Exonic
1131370467 15:91876796-91876818 ACAGCAGAGAAGAGCGCACCAGG - Intronic
1132740322 16:1408749-1408771 CCAGCAGCGGGGGGCCCTCCTGG + Intronic
1132845122 16:1997362-1997384 CAAGCAGAAAGGGGCTCCCATGG - Intergenic
1132880988 16:2161630-2161652 GGAGCAGGGAGGGGATCACCGGG - Intronic
1133222202 16:4323594-4323616 CCAGCAGGGAGGGTGACACCGGG - Intronic
1133281905 16:4671364-4671386 AGAGCAGAGAGGGGCTCACTGGG - Intronic
1133439398 16:5807827-5807849 CCAGCAGCGTGGGCATCACCTGG - Intergenic
1135176577 16:20235048-20235070 CAAGCACAGAGGGGATCACCGGG + Intergenic
1136076063 16:27818073-27818095 CCAGCAGCGCTGGCCTCACCTGG - Intronic
1137560434 16:49498762-49498784 CAAGCAGAGAGGGGCTGCCCAGG - Intronic
1138340433 16:56285559-56285581 ACAGCAGAGAGGGGCCTGCCTGG + Intronic
1138396050 16:56705554-56705576 CCAGCAGGGAGGGCCTGCCCTGG + Intronic
1138445188 16:57059079-57059101 CCAGCAGAAAGGGGCTTTTCGGG - Intronic
1139573532 16:67827672-67827694 CCAGCACAGAGGAGGGCACCTGG + Intronic
1140513418 16:75524919-75524941 CCAGCAGTGCTGGGCTCAGCTGG + Intergenic
1142969821 17:3603851-3603873 TCAGGAGAGAGGGTCTCACCTGG - Intergenic
1143585104 17:7847013-7847035 GCAACAGGCAGGGGCTCACCTGG - Exonic
1143717490 17:8785461-8785483 CCTGCAGAGAGAGGCTCACAAGG - Intergenic
1144366262 17:14547718-14547740 GCAGCAGGGATGGGCTCAGCAGG - Intergenic
1144707327 17:17378174-17378196 CCAGCAGAGAGGGCATGAACGGG - Intergenic
1145004246 17:19328544-19328566 CCAGCAAAGAGGGACACAGCTGG - Intronic
1145791131 17:27627711-27627733 CCAGCACAGAGGGCCTCGGCAGG - Intronic
1145906693 17:28520328-28520350 CCAGGAGAGAGGGGGTCCTCAGG - Intronic
1146261591 17:31425767-31425789 CCAGGAGAGACGGGTTCGCCAGG - Intronic
1146838227 17:36129626-36129648 CCAGCAGAGATTGGCTCATGAGG + Intergenic
1148119253 17:45197977-45197999 CCCGCAGAGAGGGCCCCAGCCGG - Intergenic
1148556275 17:48580708-48580730 CCAGGAGAGAGGGTCTATCCCGG + Intronic
1149657928 17:58319996-58320018 CCAGCAGAGGGGGTGTCACTGGG - Intronic
1150641556 17:66953142-66953164 CTCCCAGAGAGGGGCTCAGCTGG - Intergenic
1151586464 17:75011873-75011895 CCAGGAGAGAGGGGGTCCCTCGG - Intergenic
1152267700 17:79305858-79305880 CCAGCAGAGAGTGCATAACCTGG + Intronic
1152305944 17:79520177-79520199 CCTGTGGAGTGGGGCTCACCGGG + Intergenic
1152324556 17:79627970-79627992 CCAGCAGAGAGAGGCAGCCCAGG - Intergenic
1152461998 17:80446367-80446389 CCAGGAGAGGGGTGCCCACCCGG + Intergenic
1152656776 17:81523549-81523571 CCAGCAGGGTGGCCCTCACCTGG + Intronic
1152783063 17:82234938-82234960 CCAGCAGGGAGAGGCTGAGCCGG + Exonic
1153626830 18:7029256-7029278 CCAGCAGTGTGGGCATCACCTGG - Intronic
1154199215 18:12287750-12287772 CAGGCAGACAGGGGGTCACCAGG - Intergenic
1154959539 18:21294410-21294432 CCAGCAGAGAGGAGATAACATGG + Intronic
1156444101 18:37221931-37221953 CCAGCAGAAATGGGCTGTCCAGG - Intronic
1157794175 18:50559840-50559862 CCCGCGGAGACGAGCTCACCTGG - Intergenic
1157859856 18:51131892-51131914 CCTGCAGGCAGAGGCTCACCTGG + Intergenic
1158640081 18:59196217-59196239 CCAGCAGAGGGGGGCTCTCATGG + Intergenic
1159447566 18:68559270-68559292 CCGGAAGAGAAGGGCTGACCTGG - Intergenic
1159959039 18:74541379-74541401 CCAGCAGAGTGGCAGTCACCAGG - Intronic
1160434800 18:78841549-78841571 CCAGCAGAGAGCAGGACACCCGG - Intergenic
1162300695 19:9843222-9843244 CCAGGACAAAGGGGCTGACCTGG - Intronic
1163025314 19:14507658-14507680 TCAGGAAAGAGGGGCTCTCCCGG + Intergenic
1163313434 19:16527435-16527457 CCTGCAGACAGGGAGTCACCTGG + Intronic
1163672608 19:18637462-18637484 GCAGCAGAGAGGGCCTGAGCAGG + Intronic
1163862104 19:19747966-19747988 CCTGGAGGGAGGGGCTCCCCAGG - Intergenic
1164681522 19:30137045-30137067 TCAGCAGACAGAAGCTCACCAGG - Intergenic
1165022690 19:32936864-32936886 TCAGCAGAGAGGAGGTCCCCTGG - Intronic
1165777372 19:38412783-38412805 TCAGCAGAGAGGAGCTGACAGGG - Exonic
1166834310 19:45657953-45657975 CCAGCAGAGGGGCTCTCAGCTGG - Intergenic
1167253466 19:48414048-48414070 CCACCAGGGAGGGGTTCACTAGG - Exonic
1167314615 19:48756398-48756420 CCAGCAGACAGAAGCCCACCTGG + Exonic
1168405309 19:56107578-56107600 CCAGGAGAAAGAGGGTCACCAGG + Intronic
925763572 2:7209730-7209752 CAAGCAGAGAAGGGCTCATGGGG + Intergenic
926000106 2:9323764-9323786 GGAGCAGAGAGGCGCTCCCCAGG - Intronic
926098290 2:10096938-10096960 TGAGCAGAGAGGGGCTCCACAGG + Intergenic
927173953 2:20392370-20392392 TCAGCAGAGAGGGTCTCACTGGG - Intergenic
927644778 2:24870677-24870699 CCAGCAGAGAGGGTCATCCCTGG - Intronic
927965846 2:27267609-27267631 CAAGCAGAGAGGGCCTGGCCAGG - Intronic
932322287 2:70831168-70831190 CCAGCATTGTTGGGCTCACCTGG + Exonic
934517746 2:94999295-94999317 CCAGCAGAGCCTGGCTCAGCAGG - Intergenic
934858213 2:97741927-97741949 CCAGCTGAGAGGGGCCAATCTGG + Intergenic
937293013 2:120793394-120793416 ACAGCAGGGAGGGTCTCTCCAGG - Intronic
937445644 2:121955571-121955593 CCAGGAGATAGGGGCTGCCCGGG + Intergenic
937919185 2:127118293-127118315 CCAGCAGGGTGGGGCCCACCTGG + Intergenic
937974930 2:127576848-127576870 CCAGCAGAGAGGGGCTGGCGAGG - Intronic
938792726 2:134691114-134691136 ACAGCAGTGAGGGCCTCAGCAGG + Intronic
939156905 2:138536618-138536640 ACAGCTGAGAGGAGCCCACCTGG - Intronic
940830276 2:158457807-158457829 CCGGTAGAGAGGGGCGCACTAGG - Intronic
941896707 2:170636548-170636570 CCAGCAGAGAGGGGTTAAATGGG - Intronic
943524894 2:189004105-189004127 CCAGGAGAGAAGGGATCGCCTGG + Exonic
946579523 2:221112448-221112470 CCAGCAAAGAAGGACTAACCAGG + Intergenic
948504732 2:238421075-238421097 CCAGCAGAGAGGAAGTCTCCAGG - Intergenic
948732113 2:239972313-239972335 CCAGCAGAGTGAAGCCCACCCGG - Intronic
948813945 2:240500156-240500178 CCAGCAGTGAGGGGCGGGCCCGG - Intronic
948886483 2:240887616-240887638 CCAGCAGAGGGTGGCTACCCTGG + Intronic
1171063284 20:21987460-21987482 CCTGGAGACAGGGGCTCACACGG - Intergenic
1171138830 20:22723197-22723219 CCAGCAGAGAAGGGCTGCCAGGG + Intergenic
1171151032 20:22826677-22826699 CCCTCAGAGAGGGGCCCTCCTGG + Intergenic
1171239356 20:23552351-23552373 CCTGCAGAAAGGGGCTCAGAGGG + Intergenic
1172023801 20:31934526-31934548 CCCTCAAAGAGGGGCACACCTGG + Intronic
1172105878 20:32517142-32517164 CCAGCAGAGTGGGGGGGACCTGG - Intronic
1172841242 20:37903630-37903652 CCTGCAGAGAAGGGGGCACCCGG + Intronic
1172997034 20:39078533-39078555 CCAGCAGGGAGGAGCTGACAGGG - Intergenic
1173248559 20:41352519-41352541 GCAGCAGAGTGGGGAGCACCAGG + Intronic
1173381207 20:42544350-42544372 CCAGCAGAGCTTGGCTCATCAGG - Intronic
1173606155 20:44333224-44333246 GCAGCAGAGAGGGTCTGACTGGG + Intergenic
1173896239 20:46552855-46552877 TGAGCAGACAGGGGCTCACTTGG - Intergenic
1174759433 20:53192640-53192662 CCAGGACAGAAGGGCTCTCCTGG + Intronic
1175192875 20:57223327-57223349 CCAGCACACAGGGAATCACCTGG + Intronic
1175777529 20:61662715-61662737 CCAACACAGGGCGGCTCACCTGG + Intronic
1176051059 20:63119991-63120013 ACACCAGTGAGGGGATCACCAGG + Intergenic
1176085247 20:63292912-63292934 CCTGCAAGGAGGGGCTCACAGGG - Intergenic
1176170785 20:63695528-63695550 CCTGCTGAGAGGGGCCCGCCCGG - Exonic
1176250182 20:64116888-64116910 CCAGCAGAGGGTGGCTCCTCAGG - Intergenic
1177047201 21:16185177-16185199 CCAGGGGAGAGGGACTCAACTGG + Intergenic
1178441645 21:32603348-32603370 CCTGCTGGGAGGGGCTCAGCTGG - Intronic
1179801383 21:43813022-43813044 TCCTCAGAGAAGGGCTCACCTGG + Intergenic
1182259555 22:29063478-29063500 CCAGCAGAGAGCTGTTCACATGG + Intergenic
1183391073 22:37545997-37546019 GCAGCAGATGGGGGCTGACCCGG + Intergenic
1184323915 22:43767282-43767304 CCAGTGGAGAGGGGCTCACAGGG + Intronic
1184722990 22:46326287-46326309 CCAGGAGAGCGGAGCTCACACGG + Intronic
1185215761 22:49599181-49599203 CCAGGAGAGAAAGGGTCACCGGG + Intronic
1185266481 22:49906816-49906838 CCAGCAGTGATGGACTCTCCTGG + Intronic
1185310002 22:50149045-50149067 CCAGCTGAGAGTGGCTCACAAGG + Intronic
950191955 3:10982959-10982981 GGTGCAGAGAGTGGCTCACCTGG - Intergenic
950297606 3:11845680-11845702 ACAGCATAGATGGCCTCACCAGG + Intronic
950444907 3:13031354-13031376 ACAGCAGGGAGGGGCTCAGCTGG + Intronic
950509272 3:13415992-13416014 TCAGCAAAGAGGGACTCCCCAGG + Intronic
952876967 3:37954218-37954240 CCAGCAGAGCTGAGCTCACTTGG + Intronic
953045176 3:39288572-39288594 TCAGCAGAGATGGCCCCACCTGG + Intergenic
954611683 3:51947666-51947688 GCAGCAGAGAGGGGCCCCACAGG + Intronic
954618812 3:51984242-51984264 ACAGCAGAGTGGGGCTCAGCTGG - Intronic
954806582 3:53224272-53224294 CCAGTGTAGATGGGCTCACCAGG + Intergenic
955872407 3:63453022-63453044 CCAGCAGCGTGGGCATCACCTGG + Intronic
955904085 3:63788609-63788631 CCAACAGAGAGGGGTAAACCAGG + Intergenic
956677740 3:71752023-71752045 CCAGCAGCAAGTGGCTGACCAGG - Intronic
960505948 3:118494124-118494146 CCTGCAAAGAGGGCCACACCAGG + Intergenic
961222423 3:125211743-125211765 CCTGGAGAGAGGGGTTCACGAGG - Intronic
961941446 3:130641667-130641689 CCAGGAGAGATGGGATCCCCTGG + Exonic
962746954 3:138403934-138403956 CCAGCACTGAGGGGCCCAGCTGG + Exonic
963424896 3:145113266-145113288 CAAGCAGAGTGGGGGTCACAAGG - Intergenic
963457021 3:145556698-145556720 CAAGCAGAGTGGGGGTCACAAGG + Intergenic
965422934 3:168484847-168484869 GCTCCAGAGAGGGGCTCAGCTGG + Intergenic
968008276 3:195257391-195257413 CCAGGGGAAAGGGGCTCACCAGG + Intronic
968234507 3:197023778-197023800 CCAGGTGTGAGTGGCTCACCAGG - Intronic
968533758 4:1111455-1111477 CCAGCAGGGTGGGGCACAGCAGG - Intronic
968579251 4:1382195-1382217 CCACCAGGGAAGGCCTCACCCGG - Intronic
968794666 4:2694771-2694793 CAAGCAGCAAGGGGCTCACGTGG - Intronic
969514543 4:7639057-7639079 TCTGCAGGGAGGGGCCCACCTGG + Intronic
969635853 4:8369260-8369282 CCAGGAGGTGGGGGCTCACCAGG - Intronic
970974028 4:22022259-22022281 CCAGGAAAGAGGCCCTCACCAGG + Intergenic
976281945 4:83334611-83334633 ACAGGAACGAGGGGCTCACCAGG + Exonic
977280364 4:95032186-95032208 CCAGGAGGCAGGAGCTCACCAGG - Intronic
977401184 4:96534572-96534594 CCAACAGAGGGTGGCTCACAAGG + Intergenic
979452786 4:120892566-120892588 ACAGCAGAGTAGGGCTGACCTGG - Intronic
981031267 4:140128084-140128106 ACAGCAGAAGGGGCCTCACCAGG - Intronic
981755050 4:148133768-148133790 ACAGCAGAGAGTGGCTCACATGG + Intronic
982737890 4:159025131-159025153 CCAGCAGGGTGGGCATCACCTGG + Intronic
983004051 4:162460507-162460529 CCAGCAGAGAGGGGAACACCTGG - Intergenic
984785439 4:183563454-183563476 GCAACAGAGAGGGTCTCACTGGG - Intergenic
985853361 5:2405548-2405570 CCAGCTGAGATGGGCTTACCTGG + Intergenic
986282789 5:6337261-6337283 CCAGCAGAGAGCACCTCAGCAGG + Intergenic
986355145 5:6916360-6916382 GCAGCAAAGAGGAGCTCACAGGG + Intergenic
987308273 5:16658713-16658735 CCAGCAGGGAGAGGCTGCCCAGG + Intergenic
991198412 5:63961593-63961615 GCAGCAGAGAGGTGATCACTTGG + Exonic
991517882 5:67459541-67459563 ACTGCAGAGAGTAGCTCACCAGG + Intergenic
992133387 5:73718284-73718306 CCAGCAGACAGGGGATCAGGAGG - Intronic
994043415 5:95283969-95283991 CCGGCAGAGAGGAGCTCTTCTGG + Exonic
997621252 5:135297623-135297645 CCAGCAGAGAGAAGCACCCCAGG + Intronic
997854815 5:137363907-137363929 CCTGCAGAGAAGGGCCTACCAGG - Intronic
998014803 5:138723622-138723644 AGAGAAGAGAGGGACTCACCAGG - Intronic
1000187037 5:158869250-158869272 CCAGCAGAGAGGGCTTCACAAGG + Intronic
1001662951 5:173410232-173410254 CAAGAAGAGAGGGGCTGAGCCGG - Intergenic
1002712625 5:181204464-181204486 AAAGAAGGGAGGGGCTCACCCGG + Intronic
1002924177 6:1595383-1595405 CCAGCAGACTGGGGATCCCCAGG + Intergenic
1005508595 6:26492103-26492125 AAAGCAGAGAGGGGCTCCTCAGG + Intergenic
1007255402 6:40524716-40524738 CCAGGAGAGAGGGGCCCTCCAGG + Intronic
1007927548 6:45662636-45662658 CCAGCAGAGCGAGGCTCTCAGGG - Intronic
1009932048 6:70188090-70188112 CCAGGAGACAGAGGCTCACAAGG + Exonic
1010396327 6:75396586-75396608 ACAGCAGAGAGGAGATCAACAGG - Intronic
1012465765 6:99515201-99515223 CCGGCAGAGCGGCGCTCACACGG + Exonic
1012909780 6:105105487-105105509 TGAGGAGTGAGGGGCTCACCTGG + Intronic
1013609640 6:111782320-111782342 ACAGCAGGGAGGCGCTCATCAGG + Intronic
1016915493 6:149240414-149240436 GCAGCAGAGAGGGGCTAACTGGG - Intronic
1018082630 6:160271468-160271490 CCAGCAGAGCGGGGCAGAGCGGG - Intronic
1018159222 6:161021571-161021593 CCAGCAGATAGGACCTAACCTGG - Intronic
1018838950 6:167505483-167505505 CAGGCTGAGATGGGCTCACCTGG + Intergenic
1018968442 6:168507589-168507611 CCAGCAGTGGGGGGCGCCCCGGG - Intronic
1019761904 7:2819123-2819145 CCAGCAGCGAGCGGCTCACAAGG - Intronic
1020375130 7:7477134-7477156 CCAGGAGAGAGGGGCTTACCCGG - Exonic
1021508973 7:21414684-21414706 CCAGCAGAGATGGGGTCACTTGG - Intergenic
1027224407 7:76234958-76234980 CCAGCAGAGAGGAGCTTAACAGG + Intronic
1029710100 7:102294773-102294795 CCAGCAGGGAGGCCCCCACCTGG - Intronic
1032461426 7:132114278-132114300 CCAGCAATGAGAGGCTGACCTGG + Intergenic
1033126103 7:138708678-138708700 CCAGGAGGGAGACGCTCACCGGG - Intronic
1033942578 7:146674475-146674497 CCACCAGACAGAGGCTCAGCAGG - Intronic
1034065903 7:148136193-148136215 CAAGCAAAGATGGGCTCAGCAGG + Intronic
1034151028 7:148915478-148915500 TCCGAAGAGTGGGGCTCACCAGG - Intergenic
1034404498 7:150893452-150893474 CCAGCAGAGATTGGCTCATGAGG + Intergenic
1034583861 7:152071265-152071287 CCATAAGAGACGGGCACACCTGG + Intronic
1034951370 7:155298662-155298684 GCAGCAGGGAGGGACCCACCAGG - Exonic
1034997136 7:155584611-155584633 CCTCCAGAGAGGGGCTCCCTGGG + Intergenic
1035592017 8:823562-823584 CCAGCAGCACGGGGCTCAGCAGG + Intergenic
1036751980 8:11449345-11449367 CCGGCAGAGAGGTGCTGGCCGGG + Intronic
1037623479 8:20587647-20587669 ACAGCAGAGAGCTGCACACCAGG - Intergenic
1037820101 8:22131206-22131228 CCTGCCGAGAGAGGCTCCCCCGG + Exonic
1037898913 8:22676166-22676188 CCAGCAGAGGGGCCCTCCCCTGG + Intergenic
1039840538 8:41289993-41290015 CCAGCACAGCCAGGCTCACCAGG + Intronic
1039964998 8:42277722-42277744 CCAGCCCAGAGGAACTCACCGGG - Intronic
1040529989 8:48258904-48258926 CCAGTAGAGAGTGGCTCAAGAGG + Intergenic
1044859749 8:96511341-96511363 CCAGCAGTGTGGGCATCACCTGG + Intronic
1046037031 8:108854879-108854901 ACAGCTGAGAGGAGCTCTCCTGG + Intergenic
1046868546 8:119177650-119177672 CCAGCTGAGAACTGCTCACCTGG + Intronic
1048548177 8:135406186-135406208 CCAGTAGAGAGATGCTCTCCAGG + Intergenic
1049222165 8:141433128-141433150 TCTGCAGGGAGGGGCTCTCCAGG + Intergenic
1049398036 8:142410970-142410992 CAAGCAGAGAGGGGCACTGCTGG - Intergenic
1049436759 8:142590009-142590031 CCACCGCAGAGGGGCTCAGCGGG - Intergenic
1049572362 8:143375245-143375267 CCAGAAGCCAGGGTCTCACCAGG - Intronic
1049853903 8:144849753-144849775 CCAGCAGAGAGGCTGTCACCAGG - Intronic
1051549926 9:18316403-18316425 CCATAAGAGACGGGCACACCTGG + Intergenic
1053350286 9:37409495-37409517 TGAGCAGAAAGGGGCTCTCCAGG + Intergenic
1053567700 9:39270358-39270380 CCAGAACATAGGGGCACACCTGG - Intronic
1053833709 9:42111305-42111327 CCAGAACATAGGGGCACACCTGG - Intronic
1054596843 9:67076105-67076127 CCAGAACATAGGGGCACACCTGG + Intergenic
1057036797 9:91817239-91817261 CCAGCAGGGAGGGGCAGAACTGG + Intronic
1058265188 9:102890238-102890260 CCATAAGAGATGGGCACACCTGG - Intergenic
1060047844 9:120354583-120354605 CCAGTTGAGAGCTGCTCACCAGG - Intergenic
1060342911 9:122792730-122792752 CCTGCAGAGAGAGGCTTCCCAGG - Intergenic
1060816519 9:126638165-126638187 CCAGCAGAGAGGGGCTCACCTGG - Intronic
1060818921 9:126650617-126650639 CCAGGAGCGAGGGGGCCACCAGG - Intronic
1060826787 9:126692257-126692279 CCAGCAGAGGGGGTCTCAGTGGG + Intronic
1061225479 9:129278690-129278712 CTAGCAGAGAGGGGTGCTCCAGG + Intergenic
1061444562 9:130630653-130630675 CCAGCAGTCAGGGGCGCACGTGG + Exonic
1062052741 9:134455955-134455977 GCAGCAGGGAGCGCCTCACCTGG - Intergenic
1062248900 9:135584339-135584361 AGAGCAGAGAAGGGCTCTCCTGG - Intergenic
1062384179 9:136302564-136302586 CCAGGAGGGAGGGGCACACAGGG - Intronic
1062394898 9:136348852-136348874 CCAGCAGACAGGGGCTGAGGTGG - Intronic
1062460235 9:136659898-136659920 CCAGCACAGAGGGGGAGACCTGG - Intronic
1062631171 9:137463814-137463836 CCTGGGGTGAGGGGCTCACCTGG - Intronic
1062702158 9:137912980-137913002 CCAGCACAGAGCGGCTTGCCAGG - Intronic
1190056745 X:47185581-47185603 CCAGCAAAGAGGCGCTCATCCGG + Exonic
1191964814 X:66746424-66746446 GGAGCAGAGAGGGGCTCAGTAGG - Intergenic
1192157600 X:68758228-68758250 CCAGCAGAGGCTGGGTCACCAGG - Intergenic
1192220624 X:69195264-69195286 CCAGCAGGGAGGGCCACAGCTGG - Intergenic
1198216335 X:134558424-134558446 GTAGCGGAGAGGGGCTCACTTGG - Intergenic
1198389882 X:136163082-136163104 CCACCAGGGAGGAGCTCTCCCGG + Intronic
1199552465 X:149074572-149074594 CAAGCAGGGAGGGGCTCCCCCGG - Intergenic