ID: 1060816521

View in Genome Browser
Species Human (GRCh38)
Location 9:126638174-126638196
Sequence CCAGGGACACCAGCAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 1, 2: 10, 3: 53, 4: 480}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060816521_1060816537 11 Left 1060816521 9:126638174-126638196 CCCCTCTCTGCTGGTGTCCCTGG 0: 1
1: 1
2: 10
3: 53
4: 480
Right 1060816537 9:126638208-126638230 CGACAGGAATGCTCCGGTGGGGG No data
1060816521_1060816531 5 Left 1060816521 9:126638174-126638196 CCCCTCTCTGCTGGTGTCCCTGG 0: 1
1: 1
2: 10
3: 53
4: 480
Right 1060816531 9:126638202-126638224 GGGTCCCGACAGGAATGCTCCGG No data
1060816521_1060816534 9 Left 1060816521 9:126638174-126638196 CCCCTCTCTGCTGGTGTCCCTGG 0: 1
1: 1
2: 10
3: 53
4: 480
Right 1060816534 9:126638206-126638228 CCCGACAGGAATGCTCCGGTGGG No data
1060816521_1060816530 -5 Left 1060816521 9:126638174-126638196 CCCCTCTCTGCTGGTGTCCCTGG 0: 1
1: 1
2: 10
3: 53
4: 480
Right 1060816530 9:126638192-126638214 CCTGGCAGGTGGGTCCCGACAGG No data
1060816521_1060816532 8 Left 1060816521 9:126638174-126638196 CCCCTCTCTGCTGGTGTCCCTGG 0: 1
1: 1
2: 10
3: 53
4: 480
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816521_1060816536 10 Left 1060816521 9:126638174-126638196 CCCCTCTCTGCTGGTGTCCCTGG 0: 1
1: 1
2: 10
3: 53
4: 480
Right 1060816536 9:126638207-126638229 CCGACAGGAATGCTCCGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060816521 Original CRISPR CCAGGGACACCAGCAGAGAG GGG (reversed) Intronic
900144469 1:1151823-1151845 CCAGGGGCAGCAGGAGACAGAGG - Intergenic
900465229 1:2822155-2822177 TCGTGGACACCAGCAGAGGGCGG + Intergenic
900602258 1:3508104-3508126 CTCTGAACACCAGCAGAGAGAGG + Intronic
900795128 1:4703245-4703267 CCAGGGACTGCAGAAGAAAGTGG + Intronic
900830909 1:4964778-4964800 CCAGGGTGACCTTCAGAGAGTGG - Intergenic
901253383 1:7798934-7798956 AATGGGTCACCAGCAGAGAGAGG - Intronic
901432548 1:9225865-9225887 CCAGGGGCACCAACAGATTGTGG + Intergenic
901497257 1:9629249-9629271 CCAGTGACAACCGCAGAGGGAGG - Intergenic
901635554 1:10668591-10668613 GCACCGCCACCAGCAGAGAGTGG - Intronic
901851978 1:12021698-12021720 CAAGTGACACCTGCTGAGAGAGG + Exonic
902364798 1:15965570-15965592 CCAGGGACTGCAGCTGGGAGTGG - Intronic
903343242 1:22668079-22668101 GGAGGGACACCCGCAGTGAGGGG + Intergenic
903681493 1:25100552-25100574 CGCAGGACACCAGCAGAAAGGGG - Intergenic
904354577 1:29930761-29930783 CCAGGGACAGCTGTAGGGAGAGG - Intergenic
904869987 1:33610779-33610801 CCAGGGACAGCTGTACAGAGTGG + Intronic
904914045 1:33956935-33956957 TCAAGGGCACCAGCAGAGACTGG - Intronic
905009907 1:34740269-34740291 CCAGGGAGACCAGCAGCGAACGG - Intronic
905273901 1:36805031-36805053 CCACGGCCACCAGCACAGAGAGG + Exonic
905287338 1:36890047-36890069 GCAGACACAACAGCAGAGAGAGG + Intronic
906291246 1:44620713-44620735 CCAGGCCCAGCAGCAGAGTGAGG - Intronic
906544857 1:46613690-46613712 GCAGGCCCACCAGCAGACAGGGG + Intronic
907256564 1:53183471-53183493 CCAGGGGCAACATCAGAGACAGG + Intergenic
907338367 1:53715647-53715669 GCAGGGACGCCAGCAGGGGGCGG + Intronic
907677512 1:56532278-56532300 CCAAGACCACCAACAGAGAGAGG - Intronic
910219802 1:84878844-84878866 CCAAGGAAAACACCAGAGAGAGG - Intronic
911874216 1:103138073-103138095 CCAGGGGTACCAGCAGAGAGGGG - Intergenic
912775350 1:112503183-112503205 CCAGGGACTCCAGTGGAGTGGGG - Intronic
913168209 1:116208938-116208960 CCAGGGACATCAGCAGATGGAGG - Intergenic
913964388 1:143363280-143363302 CCTGGGAAACCAGAAGACAGTGG - Intergenic
914058757 1:144188886-144188908 CCTGGGAAACCAGAAGACAGTGG - Intergenic
914120392 1:144777485-144777507 CCTGGGAAACCAGAAGACAGTGG + Intergenic
915119394 1:153619218-153619240 CAAGGAGCACCAGCAGAGAAAGG + Intronic
915287215 1:154860699-154860721 GCAGGGACACCTGCAGACAGTGG + Intronic
915360956 1:155285988-155286010 GCAGGGTCACGAGCAGACAGTGG + Intronic
916169837 1:161993664-161993686 CCAGGTACGCCAGCACAGATGGG - Intronic
916839696 1:168586900-168586922 ACAGAGACACCAGAAGTGAGGGG - Intergenic
916840326 1:168593992-168594014 CCAGGGTCATCAGTTGAGAGTGG + Intergenic
918031074 1:180812150-180812172 ACAGGAAAACCAGCAGAGTGTGG - Intronic
918113985 1:181482058-181482080 CCAGCACCACCAGCAGAGTGTGG + Intronic
919367224 1:196677490-196677512 CCAGTGACAGCACCAGAGAATGG + Exonic
919664938 1:200282886-200282908 GCAAGGTCACCTGCAGAGAGGGG + Intergenic
919757146 1:201073357-201073379 CCAGGGACTCCTGCACTGAGAGG - Intronic
920677163 1:208046194-208046216 CGAGGCACAAAAGCAGAGAGAGG - Intronic
921242087 1:213195049-213195071 CAAGGGATAGCAGCAGGGAGAGG + Intronic
921811111 1:219515633-219515655 AAAGGGAAACCAGCAAAGAGTGG - Intergenic
922595732 1:226811327-226811349 CCTGGGACACCTGGAGAGATGGG - Intergenic
922641449 1:227235980-227236002 TCAGGGACCCCAGGAGAAAGTGG - Intronic
923289089 1:232526826-232526848 GCAGGGACATCTGCAGTGAGAGG - Intronic
923542420 1:234898113-234898135 CCAGGGTCACCAGATGAGATGGG - Intergenic
923894108 1:238250028-238250050 CCAGGGAAATTAGCTGAGAGAGG + Intergenic
1063129361 10:3164349-3164371 TCAGGGACACCAGGACAGACAGG + Intronic
1063615583 10:7597240-7597262 CCATGGACACCAGTGGGGAGGGG + Intronic
1063665103 10:8056108-8056130 CCAGGGCCACCAGCCGGGAGAGG - Intronic
1065125283 10:22568069-22568091 CCAGGAATACCTGCAGAGAGGGG - Intronic
1065292532 10:24245375-24245397 GCAGAGACCCCATCAGAGAGAGG + Intronic
1065486004 10:26237145-26237167 CAAGGGACACTTGCTGAGAGCGG - Intronic
1066520737 10:36216029-36216051 CCAGCAACACCAGCACAGAAGGG + Intergenic
1067055011 10:43045167-43045189 CCAGGGACACACGCAGAGGTGGG + Intergenic
1067756877 10:49012025-49012047 CCTGGGTCAACAGCACAGAGGGG + Intergenic
1068982241 10:63073812-63073834 TCAGGCACACCAGCATATAGGGG + Intergenic
1069636915 10:69930496-69930518 CCAGGGAGCCCAGGAGAGAAGGG + Exonic
1069817981 10:71210616-71210638 GCAGGGACCTCAGCAGAGACGGG - Intergenic
1069862116 10:71478292-71478314 CCAGGCACAGCAGGAGGGAGGGG - Intronic
1070535434 10:77373921-77373943 GCAGGGACACCAGAAGACAAAGG + Intronic
1070762112 10:79030319-79030341 CCATGATCACCAGCAGAGAGGGG - Intergenic
1070977037 10:80613727-80613749 GCAGGGATCCCAGCAGTGAGGGG + Intronic
1071450420 10:85787779-85787801 CAGGGCACAGCAGCAGAGAGGGG - Intronic
1071520910 10:86331015-86331037 CCAGGAACACCATGAGAGAAGGG + Intronic
1072107921 10:92291417-92291439 CCAGGGACAATAGCACTGAGAGG - Exonic
1072800136 10:98387054-98387076 GCAGGGACCCCGGCTGAGAGAGG - Intronic
1073262962 10:102204285-102204307 GCTGGGACACCTGCACAGAGCGG + Intergenic
1073509929 10:104036557-104036579 CCAGGGCCACCAGGAGCCAGTGG - Exonic
1074057341 10:109934432-109934454 CCAGGCATACCAGCTGACAGAGG - Intergenic
1074087420 10:110218844-110218866 CCAGGGAAGCCAGAGGAGAGAGG + Intronic
1074290661 10:112136053-112136075 CGAGGGAATCTAGCAGAGAGGGG - Intergenic
1075173683 10:120139777-120139799 CCAAGGCAACAAGCAGAGAGAGG + Intergenic
1075659321 10:124182397-124182419 CCAGGGACAGCAGCAGGGCAGGG + Intergenic
1076182090 10:128417856-128417878 CCAGTGCCGCCTGCAGAGAGTGG + Intergenic
1076380460 10:130021675-130021697 CGAGTGCAACCAGCAGAGAGGGG + Intergenic
1076442680 10:130491205-130491227 CCAGGACCACCAACAGGGAGCGG - Intergenic
1077311694 11:1891653-1891675 GCAGGGAGGCCAGCAGAGAGAGG + Intronic
1077415388 11:2422225-2422247 CCAGGGACACCACCAGGTTGGGG + Exonic
1078252270 11:9625997-9626019 GCAGGGACAGGAGGAGAGAGTGG - Intergenic
1078506756 11:11956276-11956298 CCAGTGACACCAGCACTGATTGG + Exonic
1078579383 11:12526830-12526852 AGAGGGACAAGAGCAGAGAGGGG + Intronic
1079122951 11:17698190-17698212 CGGGGGATACAAGCAGAGAGTGG - Intergenic
1079340427 11:19607114-19607136 CCAGGGACACAAACTGAGAGCGG - Intronic
1079380490 11:19933509-19933531 CCCGGGACACAAGCTGTGAGCGG + Exonic
1080773466 11:35363970-35363992 GCAGGGGCACCGGCAGAAAGAGG + Intronic
1081679348 11:44990756-44990778 CCAGTGTCACCAGCTCAGAGAGG - Intergenic
1081708933 11:45204784-45204806 CCCGGGACATCAGCAGAGCAGGG - Intronic
1084166009 11:67375036-67375058 CCAGGGGCACCAGGAAGGAGTGG - Intronic
1084173444 11:67411304-67411326 CAGGGGCCACCTGCAGAGAGAGG - Intronic
1084269428 11:68021188-68021210 CCAGGGTCACAAGCAGAGGCGGG + Intronic
1084729691 11:71065318-71065340 CCAGGGAGATGAGCAGTGAGTGG + Intronic
1084729713 11:71065428-71065450 CCAGGGAGATGAGCAGTGAGTGG + Intronic
1084729724 11:71065480-71065502 CCAGGGAGATGAGCAGTGAGTGG + Intronic
1084729734 11:71065532-71065554 CCAGGGAGATGAGCAGTGAGTGG + Intronic
1084729777 11:71065742-71065764 CCAGGGAGATGAGCAGTGAGTGG + Intronic
1084729834 11:71065955-71065977 CCAGGGAGATGAGCAGTGAGTGG + Intronic
1084729860 11:71066058-71066080 CCAGGGAGATGAGCAGTGAGTGG + Intronic
1084729875 11:71066115-71066137 CCAGGGAGATGAGCAGTGAGTGG + Intronic
1084729930 11:71066323-71066345 CCAGGGAGATGAGCAGTGAGTGG + Intronic
1085219852 11:74864755-74864777 GCAGGGACCTCAGCTGAGAGGGG - Intronic
1085939966 11:81197282-81197304 GCTGGGACACCCGGAGAGAGTGG - Intergenic
1088574417 11:111256522-111256544 GGAGGAACACCAGTAGAGAGGGG + Intronic
1088915492 11:114224743-114224765 GGAGGGACACCAGAAGAGTGTGG + Intronic
1089647103 11:119887561-119887583 CACTGGGCACCAGCAGAGAGGGG + Intergenic
1090171749 11:124611691-124611713 CCAGGGACATCAGCAACAAGGGG - Exonic
1090349801 11:126100786-126100808 ACAGAGACACCAGGAGGGAGGGG + Intergenic
1090350724 11:126106076-126106098 CCATGGAGAACAGCAGAGGGAGG - Intergenic
1090713914 11:129413369-129413391 CCAGAGTCGGCAGCAGAGAGAGG + Intronic
1090889895 11:130914636-130914658 CCAGGGACAGAAACAGAGACAGG - Exonic
1091060572 11:132457684-132457706 CCATGGACAGCACCAGAGAAAGG - Intronic
1091331910 11:134737080-134737102 ACAGGGACGCAGGCAGAGAGGGG - Intergenic
1091356432 11:134941289-134941311 TCCAGGACAGCAGCAGAGAGGGG - Intergenic
1091706250 12:2695404-2695426 GGAGGGACATCAGCAGAGGGGGG - Intronic
1091711481 12:2743634-2743656 GGAGGGACATCAGCAGAGGGGGG - Intergenic
1092501343 12:9050887-9050909 CCAGTGCCAGGAGCAGAGAGAGG - Intergenic
1093606024 12:21088715-21088737 CCATGCACTCCAGAAGAGAGTGG - Intronic
1093893005 12:24545973-24545995 TCAGGGACACCACCTGCGAGAGG - Intergenic
1094818858 12:34209705-34209727 GGACAGACACCAGCAGAGAGAGG + Intergenic
1095169814 12:39020509-39020531 CCAGGCAGCTCAGCAGAGAGAGG + Intergenic
1096254359 12:50053846-50053868 CCAGGGCTGCCAGCAGAGAGAGG - Intergenic
1096522390 12:52191698-52191720 CCAGGGGCACCAGCAGGCCGGGG + Exonic
1096799120 12:54097780-54097802 CCTGGGACACCAGCTTAGGGGGG + Intergenic
1096842947 12:54390453-54390475 CCGGGGGCACCAGGAGAGGGAGG - Intronic
1097052123 12:56230017-56230039 CAAGGGTCACCTGCAGGGAGGGG - Intergenic
1097606694 12:61763777-61763799 CCAAGCACAGCAGCAAAGAGAGG + Intronic
1098307041 12:69112793-69112815 CCATGGTAAACAGCAGAGAGTGG + Intergenic
1100691408 12:97042311-97042333 TCAGAGACAGCAGCTGAGAGAGG + Intergenic
1102421651 12:112808147-112808169 ACAGCAACACCAGCAAAGAGGGG + Intronic
1104527783 12:129540319-129540341 ACAGGGACACCAGCTGTTAGAGG + Intronic
1104566595 12:129890433-129890455 CCAGGAACACCAGCAGCCAGTGG - Intronic
1105272799 13:18893921-18893943 CCAGGGACAGAAACAGAGACAGG - Intergenic
1105295956 13:19088113-19088135 CCAGGGACCCCAGCCCAGGGTGG - Intergenic
1105628351 13:22136269-22136291 CCAGGGAAACCAGAGGACAGTGG - Intergenic
1106341210 13:28828652-28828674 CCAGGGTCAGCAGTAGAGAGAGG + Intronic
1107302043 13:38976222-38976244 CCAGGGCCACCAGGAGAATGTGG - Intronic
1107564729 13:41590175-41590197 CCATGGGCAACAGCAGAGAGGGG - Intronic
1111531707 13:89544832-89544854 CCTGGGAAACCAGGAGATAGAGG + Intergenic
1112776668 13:102850948-102850970 GCAGGAAAACCAGCAGAGCGCGG + Intronic
1113913859 13:113859719-113859741 ACATGGACACCAGCACAGATAGG - Intronic
1116487762 14:45471520-45471542 GTAGGGACATGAGCAGAGAGAGG + Intergenic
1119060777 14:71471591-71471613 ACAGGGAAACAAACAGAGAGAGG + Intronic
1120892414 14:89502861-89502883 TCAGAGACACCAACATAGAGTGG - Intronic
1121052340 14:90827774-90827796 CCACTGACACCCCCAGAGAGGGG - Intergenic
1121315160 14:92957023-92957045 CCATGGACACATGCAGAGCGTGG - Intronic
1121421358 14:93817998-93818020 GCAGAGTTACCAGCAGAGAGAGG - Intergenic
1121585283 14:95059011-95059033 ACATGGACACCAGCTGAGATTGG - Intergenic
1121637659 14:95464706-95464728 GCTGGGACACCACCTGAGAGTGG - Intronic
1121882509 14:97513663-97513685 GCAGAGACTCCAGCACAGAGTGG - Intergenic
1122168346 14:99849290-99849312 CTAAGGAGACCAGAAGAGAGCGG - Intronic
1122695250 14:103549272-103549294 CCAGAGACAGCAGAAGGGAGAGG + Intergenic
1122723240 14:103734161-103734183 GCAGGGAGATCGGCAGAGAGGGG + Exonic
1122796420 14:104208401-104208423 GCCGGGACACCAGCAGAGCCGGG + Intergenic
1122796505 14:104208792-104208814 GCCGGGACACCAGCAGAGCCGGG + Intergenic
1122796523 14:104208860-104208882 GCCGGGACACCAGCAGAGCCGGG + Intergenic
1122918020 14:104867720-104867742 CCAGTGACATCAACAAAGAGGGG - Intronic
1122919988 14:104876047-104876069 CCTGGGGCAGCAGCAGAGGGTGG + Intronic
1123126734 14:105952342-105952364 CCAGGGGCATATGCAGAGAGAGG - Intergenic
1123126758 14:105952446-105952468 CCAGGGGCATATGCAGAGAGAGG - Intergenic
1124172347 15:27387718-27387740 CCACAGACCCCAGCAGGGAGGGG + Intronic
1124516660 15:30372180-30372202 GCAGGAACACCAGCAGGGCGAGG + Exonic
1124726259 15:32158551-32158573 GCAGGAACACCAGCAGGGCGAGG - Exonic
1125857256 15:42962363-42962385 CTAGGGACACCAGCAGATACTGG + Intronic
1125919658 15:43517952-43517974 CCTGGGACAGCAGCAGAGGGTGG + Intronic
1127537302 15:59902208-59902230 CAGTGGACAGCAGCAGAGAGGGG + Intergenic
1128237999 15:66080480-66080502 CCAGAACCACCAGCACAGAGAGG - Intronic
1128510384 15:68310713-68310735 CCAGGCAAACGAGCAGAAAGGGG - Intronic
1129151737 15:73693192-73693214 ACCCAGACACCAGCAGAGAGAGG + Intronic
1129154072 15:73706848-73706870 CCAGGGACACCACCAGTTAAGGG + Intronic
1129406654 15:75323785-75323807 CCAGGGGCAGCAGGAGACAGAGG + Intergenic
1129784988 15:78304122-78304144 GCAGGGGCGGCAGCAGAGAGAGG - Intergenic
1130023723 15:80252186-80252208 CCCGGGCCAGCAGCCGAGAGGGG + Intergenic
1130545888 15:84857518-84857540 CCATGGCCACCAGCAGTGAGGGG + Exonic
1131465768 15:92654012-92654034 TCAAGGAGACCAGCAGAGTGAGG + Intronic
1131864624 15:96694422-96694444 CCAGGGACATGAGCACAGAATGG - Intergenic
1132301134 15:100776343-100776365 CCAGGGACCCTATCAGAGTGAGG + Intergenic
1132478558 16:154280-154302 CCAGGGTGACCAGCAGGCAGTGG - Exonic
1132480736 16:165036-165058 CCAGGGTGACCAGCAGGCAGTGG - Intronic
1132482497 16:173480-173502 CCAGGGTCACCAGCAGGCAGTGG - Exonic
1132483350 16:177291-177313 CCAGGGTCACCAGCAGGCAGTGG - Exonic
1132500497 16:282718-282740 AGAGGGACACCACCAGATAGGGG - Exonic
1132648482 16:1009932-1009954 CCAGGGACACCAGGAGGGGCTGG + Intergenic
1132715681 16:1288887-1288909 TCAGGGGCACCAGGAGAGACCGG + Intergenic
1132881355 16:2163071-2163093 CCAGGGACACCAGTAGGGGAAGG - Intronic
1133051913 16:3121805-3121827 CCAGGGAAAAAAGCAGAGAATGG - Intergenic
1133289980 16:4714011-4714033 CCAGAGACCCCAGCAGGGCGCGG + Intronic
1133732730 16:8590342-8590364 CCAGAGACAGAGGCAGAGAGGGG - Intergenic
1134625650 16:15720806-15720828 CCGGGGAGGCCAGCAGAGGGAGG - Intronic
1134847075 16:17449188-17449210 CCTGGGGCAGCAGGAGAGAGTGG - Intronic
1135630703 16:24033948-24033970 CCAGAGACAAGTGCAGAGAGTGG + Intronic
1136080804 16:27851546-27851568 ACAAGGTCACCAGCTGAGAGTGG + Intronic
1138030742 16:53557706-53557728 CCAGGGACTCCTGTTGAGAGGGG + Intergenic
1138575814 16:57906719-57906741 GCTGGGCCACCAACAGAGAGAGG + Intronic
1139013402 16:62660960-62660982 CCATGGAGACCAGAAGAAAGTGG + Intergenic
1139366240 16:66435192-66435214 CCAGGGACACCCCCAGAGACCGG - Intronic
1139382676 16:66543522-66543544 CCAGGGGCACACACAGAGAGGGG + Intronic
1140410467 16:74737861-74737883 CCTGGGTCAGCAACAGAGAGAGG + Intronic
1140840694 16:78836342-78836364 CCAGTGGCCCCAGCAGAGATAGG + Intronic
1141068491 16:80932646-80932668 CCAAGGACACGAGCGGAAAGTGG - Intergenic
1141130352 16:81432296-81432318 CAAAGATCACCAGCAGAGAGAGG + Intergenic
1141439802 16:84022740-84022762 CCAGGCACCCCTGCAGAGGGTGG - Intronic
1142110136 16:88326928-88326950 ACAGGGACACAGGCCGAGAGAGG - Intergenic
1142175947 16:88645478-88645500 CCAGAGACCCCCGCAGTGAGAGG + Intronic
1142280338 16:89144681-89144703 CCTGGGACTGCAGCATAGAGGGG - Intronic
1143012457 17:3873379-3873401 CCAGGGATGCCAGCAGAGCTGGG - Intronic
1143254897 17:5548816-5548838 AAAGGGACACCAGGAGAGAGAGG - Intronic
1144503451 17:15809119-15809141 CCAGGGATTCCAGCAGTCAGAGG + Intergenic
1146193352 17:30789906-30789928 CAAGGGACATAAGCAGAGAAGGG + Intronic
1146259669 17:31413228-31413250 CCAGGGACCACAGCTCAGAGTGG + Intronic
1146376758 17:32299721-32299743 CCAGTGACACCAGTGCAGAGTGG + Intronic
1146637068 17:34514408-34514430 GCCTGGACCCCAGCAGAGAGAGG + Intergenic
1147558685 17:41496010-41496032 CCAGGGACACCATCCAAAAGAGG + Intergenic
1148793639 17:50187094-50187116 CCAGGAGCACCAGCAGAGCCAGG + Exonic
1148794571 17:50190824-50190846 CCAGGGGCACCAGCAGGGCCAGG + Exonic
1149349802 17:55775083-55775105 CCTGGGGCACAAGCAGGGAGAGG - Intronic
1150280939 17:63929363-63929385 CCAACCACACCAGCAGATAGTGG + Intronic
1150631645 17:66884517-66884539 CCAGGCCCACCACGAGAGAGAGG - Exonic
1151544684 17:74785571-74785593 CCAGGAACACCAGCAGGACGAGG - Exonic
1151675870 17:75597040-75597062 CCTGGGACAGCAGCAGCGAAGGG + Intergenic
1151705663 17:75765588-75765610 CCAGGGCCAGCAGCTGTGAGAGG + Exonic
1152200058 17:78940013-78940035 CCTGGGACCCCAGCAGAAATGGG + Intergenic
1152383424 17:79954449-79954471 CCAGGGGCCCCAGCAGTGGGAGG - Intronic
1152471767 17:80493434-80493456 CCGGGGCCAGCAGAAGAGAGGGG + Intergenic
1152906755 17:82974661-82974683 CCAGGGACACCCGCTGTGGGGGG - Intronic
1153511029 18:5852812-5852834 TCAGAGACACCTGCAGGGAGAGG - Intergenic
1154251175 18:12746452-12746474 CCAGGGCCGCCAGCAGACACAGG + Intergenic
1154498217 18:14978016-14978038 TCCAGGACAGCAGCAGAGAGGGG + Intergenic
1156177708 18:34566228-34566250 ATAGGGAAACCAGCAGAGAAGGG + Intronic
1158640079 18:59196208-59196230 CCAAAGACACCAGCAGAGGGGGG + Intergenic
1158929875 18:62313705-62313727 GGAGGGAAACCAGGAGAGAGTGG + Intergenic
1160585646 18:79911929-79911951 GAGGGGACAGCAGCAGAGAGGGG + Intronic
1162732457 19:12727060-12727082 CCAAAGCCACCAGCAGAGACTGG - Intergenic
1163125216 19:15240785-15240807 GCAGGGATTCCAGCAGAGAGAGG - Intronic
1163235777 19:16029622-16029644 CCTGGGACAGGAGCAGAGGGCGG + Intergenic
1163300942 19:16445767-16445789 CCCGAGGCAACAGCAGAGAGGGG + Intronic
1163386062 19:17001396-17001418 CCAGGGAGGCCTGCAGAGGGCGG + Intronic
1165130908 19:33631404-33631426 CCAGGCACAGCAACAGGGAGGGG - Intronic
1165396217 19:35565035-35565057 CCATGGGCAGCAGCAGCGAGGGG + Intergenic
1166422803 19:42651926-42651948 CCAGGGACACCAACAGGGTATGG + Intronic
1166433101 19:42742639-42742661 CCAGGGACACCAGCAGGGTGTGG - Intronic
1166436202 19:42767864-42767886 CCAGGGACACCAGCAGGGTGTGG - Intronic
1166446076 19:42857892-42857914 CCAGGGACACCAGCAAGGTGTGG - Intronic
1166449061 19:42881841-42881863 CCAGGGACACCAGCAGGGTGTGG - Intronic
1166453457 19:42920043-42920065 CCAGGGACACAAGCAGGGTGTGG - Intronic
1166455945 19:42939354-42939376 CCAGGGACACAAGCAGGGTGTGG - Intronic
1166465738 19:43028623-43028645 CCAGGGACACCAGCAGGGTGTGG - Intronic
1166483013 19:43188649-43188671 CCAGGGACACCAGCAGGGTGTGG - Intronic
1166485494 19:43207780-43207802 CCAGGGACACCAGCAGGGTGTGG - Intergenic
1166492645 19:43271687-43271709 CCAGGGACACCAGCAGGGTGTGG - Intergenic
1166496502 19:43306638-43306660 CCACGGACACCAACAGTGTGTGG - Intergenic
1166718775 19:44985788-44985810 ACAGGACCACCCGCAGAGAGAGG - Intronic
1167168263 19:47813909-47813931 CGAGGGAGACCAGAAGACAGAGG + Intronic
1167528926 19:50002731-50002753 CCAAGGGCCCCAGCAGAGACAGG + Intronic
1167809877 19:51820096-51820118 CCAAGGCCATCAGCTGAGAGTGG + Intronic
1168405306 19:56107569-56107591 CAAGGGTCACCAGGAGAAAGAGG + Intronic
1168707384 19:58477746-58477768 CCCAGGACACCAGAATAGAGGGG + Exonic
1202698160 1_KI270712v1_random:140771-140793 CCTGGGAAACCAGAAGACAGTGG - Intergenic
925070662 2:964912-964934 CCAGGGCCAACAGGACAGAGGGG - Intronic
925355231 2:3236378-3236400 CCAGGGACATGAGCAGAGGCTGG + Intronic
927515573 2:23669931-23669953 GTAGGGACCCAAGCAGAGAGGGG + Intronic
928132588 2:28663578-28663600 CCCAGGGCACCAGCAGAGGGAGG + Intergenic
928987040 2:37191824-37191846 CCAGGAGCAGCAGCAGGGAGTGG + Intronic
930243207 2:48957149-48957171 GCTGGGAAACCAGGAGAGAGTGG + Intergenic
931172500 2:59818570-59818592 TCAGGGACACATGCAGAAAGCGG + Intergenic
931407596 2:61994931-61994953 CCATGGCCACTAGCAGATAGGGG + Intronic
931721684 2:65071717-65071739 CCAGGGTCACCAGGAGAGGGCGG + Exonic
932249804 2:70232887-70232909 CCTGGAACACCAGCAGAAAAGGG - Intronic
932417063 2:71580006-71580028 CAGGGGACACCTGGAGAGAGGGG - Intronic
933774707 2:85765134-85765156 TCAGGGAGAGCAACAGAGAGTGG + Intronic
933900564 2:86846705-86846727 CCAGGGAAACCAGCAGAACCAGG + Exonic
933994506 2:87658032-87658054 TCAGGAACACCAGCAGAGCCGGG + Intergenic
934038845 2:88110982-88111004 CCAGAGACACCTGCACAGATGGG - Exonic
934279415 2:91598554-91598576 CCTGGGAAACCAGAAGACAGTGG - Intergenic
934925123 2:98376905-98376927 CCAGTCACACCAGCAGAGTCTGG - Intronic
934986755 2:98893095-98893117 CCAGGCACAGCAGCAGGGAGCGG + Intronic
935197205 2:100824312-100824334 CCAGGGACTGCAGGAGAGGGTGG - Intronic
935372119 2:102357533-102357555 TCAGGGACCTCACCAGAGAGTGG + Intronic
935409735 2:102748329-102748351 CCAATGACAGCAGCAGTGAGAGG - Intronic
935779984 2:106502520-106502542 CCAGGGAAACCAGCAGAACCAGG - Intergenic
936139850 2:109929917-109929939 CCAGAGACACCAGCACAGTCAGG + Intergenic
936139869 2:109930028-109930050 CCAGAGACACCAGCACAGTCAGG + Intergenic
936165326 2:110115541-110115563 CAGGGGCCACCTGCAGAGAGGGG - Intronic
936204827 2:110441458-110441480 CCAGAGACACCAGCACAGTCAGG - Intronic
936204846 2:110441569-110441591 CCAGAGACACCAGCACAGTCAGG - Intronic
936246787 2:110835524-110835546 CACGGGAGACCAGCAGGGAGAGG - Intronic
936299352 2:111292881-111292903 TCAGGAACACCAGCAGAGCCGGG - Intergenic
937231089 2:120398644-120398666 ACAGGGACACCACCAGACCGAGG - Intergenic
937260227 2:120580756-120580778 CCTGGGACACCAGCGAGGAGGGG + Intergenic
938755997 2:134379516-134379538 GCAGGCACACCAGCAGATGGAGG + Intronic
939191865 2:138925815-138925837 CTAGGGAAACCAGGACAGAGCGG - Intergenic
939381849 2:141446739-141446761 CCCTGCAAACCAGCAGAGAGTGG - Intronic
942304888 2:174597629-174597651 TCAGGGACACAGGCAGACAGAGG + Intronic
943162045 2:184267208-184267230 CCAGGGACACCGTCAGAAAATGG - Intergenic
943438433 2:187896399-187896421 CCAGGGACACAGTCAGTGAGTGG - Intergenic
944244461 2:197516682-197516704 CCAGGGAAAGCGGCAGGGAGAGG - Intronic
946162045 2:217841302-217841324 CCAGGGGAGCCAGCAGGGAGTGG + Intronic
946426678 2:219602154-219602176 GCAGGGAGAGCTGCAGAGAGGGG - Intronic
946431530 2:219629234-219629256 CCCGGCACACCAGGAGAAAGAGG + Exonic
947168180 2:227283835-227283857 CCAGGCACACCAGGGCAGAGGGG + Exonic
947623912 2:231607600-231607622 GCAGGGACCCCAGCAGAGACTGG - Intergenic
947857708 2:233335325-233335347 CCAGGGTCAGCAGCAGAGCTGGG - Intronic
948561480 2:238856698-238856720 CCATGGCCAGCAGCAGAGAGAGG - Intronic
948715275 2:239857057-239857079 CCAGGGACATCAACACTGAGGGG + Intergenic
948724320 2:239922400-239922422 TCAGGGACCCCAGGACAGAGAGG + Intronic
948778350 2:240301686-240301708 TCAGAGACACCAGCAGGGACAGG + Intergenic
1168763875 20:368675-368697 GGAGGAAAACCAGCAGAGAGTGG - Intronic
1168978201 20:1983667-1983689 GCAGGGAGGCCAGCAGGGAGAGG - Intronic
1169275302 20:4229779-4229801 GCAGGGGCACAAGCAGTGAGGGG - Intronic
1169400518 20:5275388-5275410 CCTGGGTCACCAGCAGTGAAGGG - Intergenic
1169476317 20:5934176-5934198 GGAGGGAAACCAGGAGAGAGTGG + Intergenic
1170163090 20:13335875-13335897 ACAGGGAGACAAACAGAGAGAGG + Intergenic
1171431797 20:25087615-25087637 CCAGGGACAAAAGGAGAGGGAGG + Intergenic
1171446487 20:25207834-25207856 CCAGGGGCAACAGCCGAGAGGGG + Intronic
1171797304 20:29576569-29576591 CCTGGGACACCAGCTTAGGGGGG - Intergenic
1171850948 20:30307592-30307614 CCTGGGACACCAGCTTAGTGGGG + Intergenic
1171962404 20:31504191-31504213 GCTGGGACACCAGTAGAGACGGG - Intergenic
1172618946 20:36307138-36307160 CCAGGGACGCAAACAGGGAGGGG - Intronic
1172649502 20:36492892-36492914 CTATGGCCACCAGCAGAGACAGG - Intronic
1173160511 20:40648695-40648717 CCAAGGCCATCAGCAGGGAGAGG - Intergenic
1175121096 20:56716927-56716949 CCTGGGGCTCCAGCAGGGAGAGG - Intergenic
1175301389 20:57945794-57945816 ACAGAGATACAAGCAGAGAGAGG + Intergenic
1175390948 20:58627065-58627087 CCATGGACAACAGCAGAGTGCGG + Intergenic
1175848840 20:62075990-62076012 CTATGGAAACCAGAAGAGAGTGG + Intergenic
1175872302 20:62214272-62214294 CCAGGGGCCCCAGGAGAGGGAGG - Intergenic
1177997206 21:28115968-28115990 GCAGAGACACCAGCACAGGGAGG + Intergenic
1178132661 21:29590848-29590870 CAAGGGAGACCAGCTGGGAGGGG + Intronic
1178319675 21:31595915-31595937 TCAGGAACACAAGCAGGGAGAGG - Intergenic
1178384500 21:32138311-32138333 CAACGGACACCAGCAGACACTGG + Intergenic
1178900318 21:36593030-36593052 CCAGAGATCCCAGCAGGGAGAGG - Intergenic
1179251003 21:39671391-39671413 CCAGAGACCCAAACAGAGAGAGG - Exonic
1179547070 21:42119589-42119611 CCATGGAAACAAGCAGCGAGGGG - Intronic
1179547539 21:42122852-42122874 CCTGGGCCACCAGCCCAGAGAGG + Exonic
1179580129 21:42338338-42338360 CCAGGGAAACCAGGGGAGGGAGG - Intergenic
1180241668 21:46511482-46511504 CGGGGGACACCTGCAGTGAGAGG - Exonic
1180935628 22:19623289-19623311 CCAGGGACTCCAGAGGAGAAAGG + Intergenic
1181799158 22:25333073-25333095 GCAGTGACACCAGCAGAAATTGG + Intergenic
1181959257 22:26611091-26611113 CCAGAGACACCCACAGAGACAGG + Intronic
1182360619 22:29744436-29744458 CCAGGGGGACCAGCAGGGTGGGG + Intronic
1182520980 22:30884460-30884482 CCAAGGAAGCCAGCAGAGTGTGG - Intronic
1183077734 22:35437329-35437351 TCATGGACACCAAAAGAGAGAGG + Intergenic
1183205663 22:36417232-36417254 CCAGGGACACAGGCAGCAAGGGG + Intergenic
1183669218 22:39262514-39262536 CGAGGGGCTGCAGCAGAGAGAGG - Intergenic
1184118054 22:42433338-42433360 GAAGGGACACCTGCAGAGAAGGG - Intergenic
1184732186 22:46377087-46377109 TCACGAACACCAGCTGAGAGAGG + Exonic
1185009051 22:48302936-48302958 CCAGAGACAGGAGCAGACAGTGG + Intergenic
1185023103 22:48391994-48392016 CCAAGGAGACAAGCAGGGAGGGG + Intergenic
1185056043 22:48578831-48578853 CCTGGGGGACCAGCAGTGAGAGG + Intronic
1185269185 22:49920844-49920866 CCAGGGACAGCAGCAGGGGCTGG - Intronic
950407778 3:12815481-12815503 CCAGGGACACTAACAGTGAGTGG - Intronic
950767611 3:15284874-15284896 CCAGGGACACCAGCACACACTGG + Intronic
952529412 3:34248089-34248111 TCAGGGACAAGAGAAGAGAGGGG + Intergenic
952924415 3:38310708-38310730 CCAGGGACAGGAGCTGAGGGAGG - Intronic
953449728 3:42996103-42996125 CCAGGGCAACCAGCAAACAGGGG + Intronic
953811106 3:46113597-46113619 ACAGAGACCCCAGAAGAGAGAGG - Intergenic
953879692 3:46685279-46685301 CCAAGGACACCAGCTGGGAAGGG + Intronic
954130318 3:48557236-48557258 CCAGGGCCCCCAGGAGGGAGGGG + Intronic
955141608 3:56275321-56275343 CCAATGAAAACAGCAGAGAGGGG + Intronic
955349522 3:58183514-58183536 CCAGGGACAACAGGAGAAATGGG + Intergenic
955879505 3:63528783-63528805 CCAGAGACACCCACAGAGAGAGG + Intronic
955963345 3:64363384-64363406 CCAGGGACAGCAGGAGAGAGAGG + Intronic
956250644 3:67230716-67230738 CCAGGGACACCACCGTGGAGTGG - Intergenic
957662556 3:83179809-83179831 CCATGGAGACCAGAAGAAAGTGG - Intergenic
961516885 3:127443629-127443651 CCAGGCACACCAGCAGGGAGAGG + Intergenic
961532589 3:127548171-127548193 CCAAGGTCACCAGCTGGGAGTGG + Intergenic
961602144 3:128070668-128070690 CCAGTGTCGTCAGCAGAGAGAGG + Exonic
962210688 3:133475059-133475081 CCAGGGAATCCAGCAGGGACTGG - Exonic
962310707 3:134324897-134324919 CCAGTGAGACCAGCAGTGATGGG - Intergenic
962708410 3:138066678-138066700 CCAGCAACACCAACATAGAGGGG + Intronic
962777431 3:138675625-138675647 CCAGGGAAGCCAGAAGAAAGTGG + Intronic
962826014 3:139101568-139101590 CAGGGGCCACCTGCAGAGAGGGG + Intronic
963046446 3:141106156-141106178 CCAGGGACACCAGCCCACACAGG - Intronic
963957592 3:151272460-151272482 CCAGGTGCACCAGCACACAGTGG + Intronic
964806595 3:160617059-160617081 TCAGGGACACAATCAGACAGGGG - Intergenic
966888372 3:184389010-184389032 CCAGGGTCAGCAGCTGTGAGTGG + Intronic
966971682 3:185050594-185050616 CCTCGGTCACCAGCAGTGAGTGG - Intronic
967144132 3:186591692-186591714 CCAGGCACCCCAGCAGAGAAAGG - Intronic
967144992 3:186599003-186599025 TTAGAGACACCATCAGAGAGTGG + Intergenic
967192477 3:186996857-186996879 GCAGGGACCCAAGCAGAGAGGGG - Intronic
967375992 3:188801700-188801722 CCAAGGTCACCAGCAAAGAATGG - Intronic
967984046 3:195082339-195082361 CCAGGAAGACCACCAGGGAGGGG - Intronic
968488862 4:879113-879135 CCAGGGAGACCACGAGAGAATGG + Intronic
968545489 4:1195640-1195662 CCAGGGCCATCAGCAGGCAGAGG + Intronic
968578751 4:1379991-1380013 GCAGGGACCCCAGAAGAGCGTGG - Intronic
968584633 4:1410467-1410489 CTCGGGACACCAGAAGCGAGAGG + Intergenic
968695679 4:2025112-2025134 CCAGGCACACCAGCTGTGGGTGG - Intronic
969031340 4:4217364-4217386 CCTGGGAAACCAGAAGACAGTGG + Intronic
969153894 4:5193218-5193240 GCAGTGACACAAGCTGAGAGCGG - Intronic
969320453 4:6409429-6409451 CCAGGCCCACCAGCATGGAGCGG + Intronic
969373858 4:6750371-6750393 GCAGGGACACGGGCACAGAGGGG + Intergenic
969485000 4:7467287-7467309 GCCAGGACAGCAGCAGAGAGTGG + Intronic
969490911 4:7498806-7498828 CCATGGACACCCGCAGAGGGAGG - Intronic
969599567 4:8167992-8168014 CCAGCAGCCCCAGCAGAGAGAGG + Intergenic
969610635 4:8225896-8225918 CCAGGGACTTCGGCAGAGGGTGG - Intronic
969672799 4:8598915-8598937 CCAAGGACACCACCAGGGTGTGG - Intronic
969853298 4:9979212-9979234 CCTTGGACGCAAGCAGAGAGAGG - Intronic
970280824 4:14452883-14452905 CCAGGGACGCCAGCAGAGAGCGG - Intergenic
970425360 4:15940850-15940872 CCAATGACACCAACAGAGAGGGG - Intergenic
970463922 4:16304347-16304369 CCAATGGCACCAACAGAGAGGGG + Intergenic
970465282 4:16316244-16316266 GCAGACACACCAGCAGAGTGTGG + Intergenic
971838465 4:31800749-31800771 CCAGGCACCTCAGCACAGAGAGG - Intergenic
973605350 4:52581627-52581649 CCAGGGACCCACTCAGAGAGGGG - Intergenic
974549243 4:63349686-63349708 CCAAGGCCACCACCAGCGAGGGG + Intergenic
974878034 4:67721372-67721394 CCAGTCACAGTAGCAGAGAGAGG + Intergenic
976080162 4:81346270-81346292 TCAGGGTCACCAGGGGAGAGGGG + Intergenic
983046001 4:162986566-162986588 CCGGGGAAACAAGAAGAGAGAGG + Intergenic
983844784 4:172504449-172504471 CCAGGGAAACCAATAGATAGGGG + Intronic
983855558 4:172639672-172639694 ACAAGGACATCAGCTGAGAGGGG - Intronic
985849530 5:2378605-2378627 CCGGCCACACCAGCAGGGAGAGG - Intergenic
988095681 5:26606197-26606219 CCAGTGACACCTGCTGAGAGAGG - Intergenic
990905161 5:60795475-60795497 CCAGGCATTCCAGCAGGGAGCGG + Intronic
993873543 5:93279701-93279723 GCAGGGAGAGGAGCAGAGAGGGG - Intergenic
994715402 5:103315590-103315612 CCATGCAAACCAGCAGAGAGAGG + Intergenic
996624000 5:125547534-125547556 CCATGGAGACCAGAAGGGAGTGG - Intergenic
996888639 5:128389738-128389760 CCAGAGACCCCTGCAAAGAGTGG + Intronic
997281813 5:132653689-132653711 CCAAGGACATCAGAAGAGAAGGG + Intergenic
997429066 5:133824982-133825004 CCAGGGACACCAGGAAAAGGTGG - Intergenic
997776262 5:136609298-136609320 AAAGGGAAACCAGAAGAGAGTGG + Intergenic
998131063 5:139651253-139651275 CCAGGGTCACCTGCTGAGCGGGG - Intronic
998761156 5:145433674-145433696 CCCGAGACACCAGCAGAGGTTGG + Intergenic
1000360653 5:160443536-160443558 AAAGGGACCTCAGCAGAGAGTGG - Intergenic
1001047425 5:168385441-168385463 CCACCGACACCAACAGAGAATGG + Intronic
1001453945 5:171846645-171846667 CCAGGGCCAGCACCAGACAGAGG + Intergenic
1001544573 5:172563082-172563104 CCAGGGAGCCCAGGAGAGAAAGG + Intergenic
1002134796 5:177100894-177100916 CCAGGGACGCTGGCAGGGAGGGG - Intergenic
1002212703 5:177608204-177608226 GCAGGGCCACCAGGAGAAAGGGG + Intronic
1002337697 5:178491607-178491629 ACAGGAGCACAAGCAGAGAGCGG + Intronic
1002521763 5:179796283-179796305 CCAGCGCCACCAGCAGCCAGAGG - Exonic
1002644953 5:180648572-180648594 CCAGGGACACCAGCTCCGTGGGG + Intronic
1003080430 6:3016982-3017004 CCAGGTAGACCAGCTGCGAGTGG + Exonic
1003368487 6:5500474-5500496 CCAGCCACACCAGCGGAGGGTGG + Intronic
1003395204 6:5747115-5747137 CCATGGACACCAGCCAAGAGAGG + Intronic
1003502451 6:6713609-6713631 CAAGGAACTCCAGCAGAGTGTGG + Intergenic
1003674955 6:8194512-8194534 CCAGGGTCACCAGCTTAAAGAGG - Intergenic
1004175677 6:13337912-13337934 TCATGGACAGCACCAGAGAGGGG - Intergenic
1005116553 6:22344938-22344960 CCAGGGAGACCAGCATTGAAGGG - Intergenic
1005450003 6:25963150-25963172 GCAGTGACCCCAGCAGAGAGGGG + Exonic
1013085659 6:106854857-106854879 CCAGGAACACCTGCAAAGACTGG - Intergenic
1013680657 6:112521874-112521896 CCAGGAACACCTGTAGGGAGAGG + Intergenic
1013980472 6:116121754-116121776 CCAGGAAAACCAGGAGAGAGAGG - Exonic
1016947056 6:149545297-149545319 CCACGGAAACCAGAAGAGGGCGG - Intronic
1017057912 6:150454457-150454479 CCTGGAAAACCAGCAGGGAGAGG + Intergenic
1017567751 6:155706572-155706594 GCAGGGATACCACCAGAAAGAGG + Intergenic
1017830569 6:158124701-158124723 CAATGGACTCCAGAAGAGAGTGG + Intronic
1019842644 7:3463721-3463743 GGAGTGAGACCAGCAGAGAGGGG - Intronic
1019991293 7:4693590-4693612 CCAAGGGCACCATCAGAGAGCGG - Intronic
1020057563 7:5128431-5128453 CCAGGGGCAGCAGCAGGGACCGG + Intergenic
1020081884 7:5290703-5290725 CCAGAGACACCAGGTGAGACGGG - Intronic
1020378674 7:7517211-7517233 CCAGGGGGACAAGCAGAGAGGGG + Intronic
1021750057 7:23788447-23788469 GGAGGGACACCAGTGGAGAGAGG - Intronic
1021799005 7:24285285-24285307 CCAGGCACACGAGCAGGGACAGG - Exonic
1023791459 7:43757009-43757031 CAAGGGGCAGCAGCAGGGAGGGG + Intergenic
1024569429 7:50711404-50711426 CCAGGGACATCAGCTGAGACGGG + Intronic
1031858978 7:126957339-126957361 GCAGGGACACCAGCTGAGTGGGG + Intronic
1032128471 7:129211294-129211316 CCAGGGGCAGAAACAGAGAGGGG - Intronic
1033841200 7:145375961-145375983 CCATGGACACCAGAACAAAGTGG + Intergenic
1034439727 7:151080598-151080620 CCAGGGACGCCAGGAGACCGTGG + Intronic
1034854678 7:154531339-154531361 CCATGGTGACCAGAAGAGAGTGG + Intronic
1035077744 7:156192078-156192100 CCATGGACAGAAGAAGAGAGTGG - Intergenic
1035447245 7:158951498-158951520 CCAGGGCCACAAGGAGAGACTGG + Intronic
1035671410 8:1420420-1420442 CCTGGGACACCAGCGTAGAGTGG - Intergenic
1035785039 8:2253413-2253435 CCTTGGACACCAGGGGAGAGGGG - Intergenic
1035807772 8:2468303-2468325 CCTTGGACACCAGGGGAGAGGGG + Intergenic
1035888537 8:3320052-3320074 CCATGAACTCCAGCATAGAGGGG + Intronic
1036078801 8:5529876-5529898 GCAAGGACACCAGAACAGAGGGG + Intergenic
1036193110 8:6689446-6689468 CCGTGGAGACCAGAAGAGAGTGG - Intergenic
1036276068 8:7353059-7353081 CTAGGGGTACCAGTAGAGAGGGG + Intergenic
1037024129 8:14011097-14011119 CTTGGGAGAGCAGCAGAGAGGGG - Intergenic
1037762697 8:21752434-21752456 GCAGGGAGCCCAGCAGAGAGTGG - Intronic
1037945649 8:22987912-22987934 CCAGGGTCACAAGGAGAGAGTGG - Intronic
1038292115 8:26259366-26259388 ACAGGGACAGCAGGAGAGGGTGG - Intergenic
1038697619 8:29819878-29819900 CCTGGCACAGCAGGAGAGAGCGG - Intergenic
1038940099 8:32295008-32295030 ACAGTAACATCAGCAGAGAGAGG - Intronic
1040578034 8:48671459-48671481 CCACGCACAACAGCAAAGAGAGG - Intergenic
1041691628 8:60693395-60693417 CTTGGGGCACCTGCAGAGAGAGG + Intronic
1041934871 8:63323475-63323497 CCAGGCACACGAGCTGGGAGGGG - Intergenic
1042380504 8:68107743-68107765 CCCAGGACACCAGGAGAGAATGG - Intronic
1042712874 8:71737616-71737638 TCAGGGAGGCCAGCAGACAGAGG + Intergenic
1042823547 8:72957449-72957471 CCAAGGACAGAAGAAGAGAGAGG + Intergenic
1043803520 8:84642700-84642722 CCAGGGACACCAGCCCTGAAGGG - Intronic
1045543822 8:103110817-103110839 CCAGGGCCACCAGAGTAGAGTGG - Intergenic
1045553288 8:103191864-103191886 CCAGGGAAAGCTGCAGAGACAGG + Intronic
1045752288 8:105499106-105499128 TGGGGAACACCAGCAGAGAGAGG - Intronic
1046981923 8:120345542-120345564 CCAGGGACCCCAGGAGAACGAGG + Exonic
1047301175 8:123614483-123614505 CCTGGGACACCAAGAGACAGTGG - Intergenic
1047903665 8:129450023-129450045 CCAGGGACACCTGCCTACAGAGG + Intergenic
1048569171 8:135636775-135636797 CCAGGGACACCCACAAAGAGAGG + Intronic
1048625290 8:136178592-136178614 ACAGGGACACCTGGAGAGGGAGG - Intergenic
1048729667 8:137424669-137424691 CCAGGCACCCCACCTGAGAGGGG - Intergenic
1048956635 8:139542905-139542927 GCAGCCACAGCAGCAGAGAGAGG - Intergenic
1049191845 8:141292613-141292635 TGAGGGACACCAGCAAGGAGGGG - Intronic
1049569035 8:143359832-143359854 GCAGGGCCACCAGGAGGGAGGGG - Intronic
1049600287 8:143504348-143504370 CCAGGGACAGGGTCAGAGAGAGG + Intronic
1050160456 9:2713770-2713792 CAAGGGAGACCTGCAGAGGGTGG - Intergenic
1052384307 9:27806494-27806516 AGAGGGGTACCAGCAGAGAGGGG + Intergenic
1052636523 9:31113210-31113232 CCATGGAAACCTGAAGAGAGTGG + Intergenic
1053494067 9:38536670-38536692 CCAGGGATGCCAGCGGAAAGAGG - Intergenic
1053684880 9:40511749-40511771 CCAGGGACACAAACAAAGTGAGG - Intergenic
1053788728 9:41670884-41670906 CCTGGGACACCAGCTTAGGGAGG + Intergenic
1053802735 9:41774564-41774586 CCAGGGACCCCAGCACAAAACGG - Intergenic
1054156412 9:61643884-61643906 CCTGGGACACCAGCTTAGGGAGG - Intergenic
1054177010 9:61882223-61882245 CCTGGGACACCAGCTTAGGGAGG + Intergenic
1054278847 9:63113207-63113229 CCAGGGACACAAACAAAGTGAGG + Intergenic
1054297971 9:63347212-63347234 CCAGGGACACAAACAAAGTGAGG - Intergenic
1054395989 9:64651730-64651752 CCAGGGACACAAACAAAGTGAGG - Intergenic
1054430633 9:65156925-65156947 CCAGGGACACAAACAAAGTGAGG - Intergenic
1054499747 9:65864596-65864618 CCAGGGACACAAACAAAGTGAGG + Intergenic
1054660524 9:67698583-67698605 CCTGGGACACCAGCTTAGGGAGG - Intergenic
1055688899 9:78808775-78808797 CAAGGAAAAGCAGCAGAGAGAGG - Intergenic
1057310428 9:93939593-93939615 CAAGGGACCCCAGAAGAGAGGGG + Intergenic
1057653959 9:96937998-96938020 CCAGGTAGAGCAGCAGAGGGAGG + Exonic
1057707172 9:97403659-97403681 CCATGGAGACCAGCAGGCAGTGG - Intergenic
1057841427 9:98488304-98488326 CCTAGAACCCCAGCAGAGAGAGG - Intronic
1059341984 9:113602461-113602483 CCAAGGACCAGAGCAGAGAGGGG - Intergenic
1060020497 9:120126281-120126303 CCAGTTACTCCATCAGAGAGTGG - Intergenic
1060051406 9:120381076-120381098 CCAGGGAAAGGATCAGAGAGTGG - Intergenic
1060402894 9:123358376-123358398 CCAGGGAGCCCAGCAGACAAAGG + Intronic
1060722517 9:125988521-125988543 CTAGGGAGACCAGGACAGAGAGG - Intergenic
1060747661 9:126148371-126148393 CAGGAAACACCAGCAGAGAGTGG + Intergenic
1060816521 9:126638174-126638196 CCAGGGACACCAGCAGAGAGGGG - Intronic
1061679337 9:132235272-132235294 CCAGAGACATCAGCTCAGAGAGG + Intronic
1061729633 9:132603823-132603845 CCTGGGTCACCTGCAGACAGCGG - Intronic
1061957189 9:133969836-133969858 ACAGGGACACCTGGAGAGGGAGG - Intronic
1061992399 9:134166544-134166566 CCAGAGGCACCAGCAGACACAGG - Intergenic
1062020611 9:134317788-134317810 ACATGGACACTGGCAGAGAGGGG - Intronic
1062362040 9:136192913-136192935 CCAGCGACGCCAGCAGAGCCGGG + Intergenic
1062725039 9:138068040-138068062 CCAGTGACATCAGCACAGTGTGG + Intronic
1185599359 X:1328188-1328210 CCAGGGATCCCAGGAGTGAGGGG - Intergenic
1187700537 X:21960870-21960892 CCAAGGTCACAAGTAGAGAGAGG + Intronic
1188981229 X:36729064-36729086 CAGGTGGCACCAGCAGAGAGTGG - Intergenic
1189339739 X:40195742-40195764 CCAGGCAGAGCATCAGAGAGAGG + Intergenic
1189352210 X:40284239-40284261 CTAGGGCCACCATCAGTGAGAGG - Intergenic
1190304376 X:49073762-49073784 CCAGGGACGTCTGCAGAGCGTGG - Intronic
1192157552 X:68757886-68757908 CCAGGGTCACCAATAGAGTGAGG - Intergenic
1195211051 X:102652368-102652390 CCTGGAACACCATTAGAGAGGGG - Intronic
1195335341 X:103848073-103848095 GCAGGGATACCACCAGAGTGGGG - Intergenic
1196950106 X:120868492-120868514 CTAGGACCACCAGCAGAGCGGGG - Intergenic
1197439437 X:126471672-126471694 CCAGGAAGCTCAGCAGAGAGAGG + Intergenic
1198581498 X:138069994-138070016 CCATGGAGACCAGAAGACAGTGG - Intergenic
1199671124 X:150149072-150149094 CCAGGGACAGCAGCAGAGGATGG - Intergenic
1199739028 X:150715151-150715173 CCAGGGTCACCAAAGGAGAGTGG - Intronic
1199793858 X:151177549-151177571 CCAGGGCGAACGGCAGAGAGAGG + Intronic
1201251153 Y:12058849-12058871 CCATGGAATCCAGAAGAGAGTGG + Intergenic