ID: 1060816523

View in Genome Browser
Species Human (GRCh38)
Location 9:126638175-126638197
Sequence GCCAGGGACACCAGCAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 430}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060816523_1060816531 4 Left 1060816523 9:126638175-126638197 CCCTCTCTGCTGGTGTCCCTGGC 0: 1
1: 0
2: 5
3: 39
4: 430
Right 1060816531 9:126638202-126638224 GGGTCCCGACAGGAATGCTCCGG No data
1060816523_1060816530 -6 Left 1060816523 9:126638175-126638197 CCCTCTCTGCTGGTGTCCCTGGC 0: 1
1: 0
2: 5
3: 39
4: 430
Right 1060816530 9:126638192-126638214 CCTGGCAGGTGGGTCCCGACAGG No data
1060816523_1060816536 9 Left 1060816523 9:126638175-126638197 CCCTCTCTGCTGGTGTCCCTGGC 0: 1
1: 0
2: 5
3: 39
4: 430
Right 1060816536 9:126638207-126638229 CCGACAGGAATGCTCCGGTGGGG No data
1060816523_1060816532 7 Left 1060816523 9:126638175-126638197 CCCTCTCTGCTGGTGTCCCTGGC 0: 1
1: 0
2: 5
3: 39
4: 430
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816523_1060816534 8 Left 1060816523 9:126638175-126638197 CCCTCTCTGCTGGTGTCCCTGGC 0: 1
1: 0
2: 5
3: 39
4: 430
Right 1060816534 9:126638206-126638228 CCCGACAGGAATGCTCCGGTGGG No data
1060816523_1060816537 10 Left 1060816523 9:126638175-126638197 CCCTCTCTGCTGGTGTCCCTGGC 0: 1
1: 0
2: 5
3: 39
4: 430
Right 1060816537 9:126638208-126638230 CGACAGGAATGCTCCGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060816523 Original CRISPR GCCAGGGACACCAGCAGAGA GGG (reversed) Intronic
900485034 1:2918606-2918628 CCCAGGGCCACCAGCGGGGAAGG - Intergenic
900797917 1:4720504-4720526 GCCAAGGACACCTGCAGCCATGG - Intronic
900830804 1:4963828-4963850 GCCAGGGACACCCACAAAGCTGG + Intergenic
900997518 1:6130452-6130474 GCCGGAGACCCCATCAGAGACGG + Intronic
901491249 1:9597447-9597469 GCCGGGGCCACCAGCAGGCAAGG - Intronic
902148145 1:14420698-14420720 GCCAGGTCCCCCAGCAGAGACGG - Intergenic
903343241 1:22668078-22668100 GGGAGGGACACCCGCAGTGAGGG + Intergenic
904755609 1:32766911-32766933 GCCAGGGCCTCCAGGAGAGGGGG + Intronic
904858515 1:33517915-33517937 GCAAAGGCCACCAACAGAGATGG - Intronic
905893452 1:41531006-41531028 GCCAGGGATGACAGGAGAGATGG + Intronic
906688535 1:47777996-47778018 GCCAGAGACAGCAACGGAGAAGG + Intronic
906800326 1:48731605-48731627 GCCAGGCAAAGCAGCACAGATGG + Intronic
907764407 1:57394578-57394600 TCCAGGGGCATCTGCAGAGAAGG - Intronic
909185319 1:72479801-72479823 GCCCGTGAAATCAGCAGAGAGGG - Intergenic
909384138 1:75036409-75036431 CCCAGGGAGACCAACATAGAAGG + Intergenic
911270549 1:95796955-95796977 CCCAGTGAGATCAGCAGAGAAGG + Intergenic
911874218 1:103138074-103138096 GCCAGGGGTACCAGCAGAGAGGG - Intergenic
912431672 1:109631380-109631402 GACAGGGCCACCAGCAGGGGAGG - Exonic
912957600 1:114166396-114166418 GGCAGTGACAACAGCAGAAATGG - Intergenic
913314643 1:117539652-117539674 GGGTGGGACTCCAGCAGAGAGGG - Intergenic
914825342 1:151135179-151135201 GCCGGGCACACCGGCTGAGAGGG + Exonic
915526993 1:156482011-156482033 GACAGAGACAGCAGGAGAGATGG + Intronic
915580113 1:156808513-156808535 GCCTGGGGCACCAGCAAGGAGGG + Intronic
916169839 1:161993665-161993687 CCCAGGTACGCCAGCACAGATGG - Intronic
916589793 1:166179333-166179355 GTCTGGGACACAAGCAGAGAAGG - Intergenic
917037614 1:170766099-170766121 GCCTGGGGGACCATCAGAGAAGG - Intergenic
918382382 1:183969101-183969123 CCCAGGGACAGCAACATAGAGGG + Intronic
919664937 1:200282885-200282907 GGCAAGGTCACCTGCAGAGAGGG + Intergenic
919886012 1:201935449-201935471 GCCATGGGAAACAGCAGAGAAGG - Intronic
920196032 1:204228031-204228053 GCCAGGGAAACCAGCTGACCAGG - Intronic
920517962 1:206600444-206600466 CCCAGGGATGACAGCAGAGAGGG + Intronic
920820267 1:209373900-209373922 GGCAGGGGCAGCAGCAGGGAAGG - Intergenic
922508679 1:226143449-226143471 GCCAGGGAGAGAAGCAAAGATGG + Intergenic
922595734 1:226811328-226811350 GCCTGGGACACCTGGAGAGATGG - Intergenic
922678315 1:227567456-227567478 GGCTGGGACACCTGCAGAGGAGG - Intronic
923542422 1:234898114-234898136 CCCAGGGTCACCAGATGAGATGG - Intergenic
923748837 1:236727848-236727870 CCCAGGGCCACCTGCAGAAACGG + Intronic
923854654 1:237833080-237833102 GCCATGGACACCAGTTGCGAAGG + Exonic
924605523 1:245531453-245531475 CCCTGGGAGGCCAGCAGAGAAGG - Intronic
1062962421 10:1582660-1582682 GCCACAGACACCAGCAGATGTGG - Intronic
1062964228 10:1594949-1594971 GCCCTGGTCCCCAGCAGAGATGG - Intronic
1063357214 10:5412637-5412659 GCCCGGGAGACCGGCAGGGACGG - Exonic
1063377325 10:5562002-5562024 GCGGGGGACACCAGGAGAGGGGG - Intergenic
1063615581 10:7597239-7597261 GCCATGGACACCAGTGGGGAGGG + Intronic
1064154089 10:12889263-12889285 GCCCGGGTAGCCAGCAGAGAGGG + Intergenic
1064311780 10:14218270-14218292 CCCATTCACACCAGCAGAGAAGG + Intronic
1064434121 10:15295805-15295827 GCCAGGGAGGCCAGCTGAAAAGG + Intronic
1065125285 10:22568070-22568092 GCCAGGAATACCTGCAGAGAGGG - Intronic
1066520735 10:36216028-36216050 TCCAGCAACACCAGCACAGAAGG + Intergenic
1067055009 10:43045166-43045188 CCCAGGGACACACGCAGAGGTGG + Intergenic
1067141331 10:43659610-43659632 ACCATGGACACCTGCAGAGCAGG - Intergenic
1067141864 10:43664668-43664690 ACCATGGACACCTGCAGAGTAGG + Intergenic
1067278113 10:44852079-44852101 CCCAGGCACACCAGCAGGGCCGG + Intergenic
1067693426 10:48519086-48519108 CCTAGGGACAGGAGCAGAGACGG + Intronic
1067756875 10:49012024-49012046 GCCTGGGTCAACAGCACAGAGGG + Intergenic
1068982240 10:63073811-63073833 GTCAGGCACACCAGCATATAGGG + Intergenic
1069373795 10:67773648-67773670 TCCAGGGATGCCAGGAGAGAAGG - Intergenic
1069636913 10:69930495-69930517 CCCAGGGAGCCCAGGAGAGAAGG + Exonic
1069773471 10:70913699-70913721 CCCAGGGCCAGCAGCAGAGTTGG + Intergenic
1069817982 10:71210617-71210639 AGCAGGGACCTCAGCAGAGACGG - Intergenic
1070309927 10:75265854-75265876 CTGAGGGACACCAGCAGAGCAGG + Intergenic
1070762114 10:79030320-79030342 CCCATGATCACCAGCAGAGAGGG - Intergenic
1070834011 10:79436672-79436694 GCGATGGTCACCAGCAGGGAAGG + Intronic
1070999634 10:80817622-80817644 CCCAGCGAGACCAGCACAGAAGG + Intergenic
1071062403 10:81588299-81588321 GCCAGGATCACCAGCAAACAAGG + Intergenic
1071450421 10:85787780-85787802 GCAGGGCACAGCAGCAGAGAGGG - Intronic
1071488006 10:86115717-86115739 GCCAGCGACCCCAGCACACAGGG + Intronic
1071520908 10:86331014-86331036 CCCAGGAACACCATGAGAGAAGG + Intronic
1074216461 10:111389559-111389581 GCCAGGGACAGTGGAAGAGATGG - Intergenic
1075477526 10:122749099-122749121 GCCTGGGAAACCAGGAGATATGG + Intergenic
1075659319 10:124182396-124182418 CCCAGGGACAGCAGCAGGGCAGG + Intergenic
1075948975 10:126461140-126461162 GACAGTGACAGCAGCAGTGATGG - Intronic
1076311280 10:129509413-129509435 GCCAGGCACACACACAGAGAAGG - Intronic
1076380459 10:130021674-130021696 GCGAGTGCAACCAGCAGAGAGGG + Intergenic
1076538938 10:131201316-131201338 GGCAGGGACAGCGACAGAGAGGG + Intronic
1076689353 10:132213373-132213395 GACAGGGATTCCAGCAGAGAGGG + Intronic
1076747083 10:132519917-132519939 GCCAGGGACACCATCATGGATGG + Intergenic
1076854309 10:133108437-133108459 GGGAGGGACACCAGAAGGGAAGG + Intronic
1077407977 11:2391157-2391179 GCCAGGGGCACCAGGAGGAAGGG - Intronic
1077889988 11:6411711-6411733 GCCAGGAACACCACTAGAGTGGG + Intronic
1078459445 11:11502550-11502572 GCCAGTGTCAGCAGCAGAGATGG + Intronic
1078545825 11:12246270-12246292 GCCAGAGACAGCAGCAGGCAGGG - Intronic
1080052843 11:27874432-27874454 AGCAGGGACACCAGCAAAGGGGG - Intergenic
1081700669 11:45150612-45150634 GCCATGGACACCAGTAAGGATGG - Intronic
1081708935 11:45204785-45204807 CCCCGGGACATCAGCAGAGCAGG - Intronic
1081844995 11:46234288-46234310 GCCAGGAAAAGCAGTAGAGATGG - Intergenic
1082823368 11:57560269-57560291 GCCAGGGACATGGGCAGGGAGGG - Intronic
1082997203 11:59263696-59263718 GCCAGGAACACCTGCAGAGGAGG + Intergenic
1083266246 11:61548231-61548253 GCCAGGGACACACCCAGAGAAGG - Intronic
1083353674 11:62049124-62049146 GCCATGGAGTCCAGCAGAGCAGG - Intergenic
1083457117 11:62786718-62786740 GCCAGGGTCACCGAAAGAGAAGG - Exonic
1083670625 11:64298089-64298111 GCCTGGGATACCACCAGGGAAGG - Exonic
1083890608 11:65593916-65593938 GGCAGGGACCCCAGCAGACATGG - Intronic
1083989425 11:66237777-66237799 GCCAGGCAAACAAGGAGAGAAGG + Intronic
1084269426 11:68021187-68021209 GCCAGGGTCACAAGCAGAGGCGG + Intronic
1087849404 11:103010859-103010881 TCCAGGGAGACCAGCTGAGGAGG - Intergenic
1089175775 11:116547846-116547868 GCCAGGGACCCAGGGAGAGAGGG - Intergenic
1089650573 11:119910238-119910260 GCCAGGGGCACCTGGATAGATGG + Intergenic
1090168599 11:124578167-124578189 GCCAGGGACATCAGCAGCAGCGG - Intergenic
1090171751 11:124611692-124611714 GCCAGGGACATCAGCAACAAGGG - Exonic
1091331911 11:134737081-134737103 GACAGGGACGCAGGCAGAGAGGG - Intergenic
1091706251 12:2695405-2695427 GGGAGGGACATCAGCAGAGGGGG - Intronic
1091711482 12:2743635-2743657 GGGAGGGACATCAGCAGAGGGGG - Intergenic
1092398895 12:8154308-8154330 CCCAGTGAGACCAACAGAGAAGG - Intronic
1093373006 12:18387209-18387231 GCCAAGGAAACCAGCAGATGAGG - Intronic
1095595197 12:43950895-43950917 CCCAGGGAGACCAACACAGAAGG + Intronic
1096779243 12:53982792-53982814 GCCTGGGGAACCAGCAGACAGGG - Intergenic
1096799118 12:54097779-54097801 GCCTGGGACACCAGCTTAGGGGG + Intergenic
1096807666 12:54150346-54150368 GCCAGGGGCAGGGGCAGAGAGGG + Intergenic
1097052124 12:56230018-56230040 GCAAGGGTCACCTGCAGGGAGGG - Intergenic
1098781239 12:74688776-74688798 GCGAGGGTCACAGGCAGAGAAGG - Intergenic
1100352381 12:93796931-93796953 GCCAGTGAAAGCAGCAGAGGTGG - Intronic
1103389682 12:120562914-120562936 GCCAGAGAGAACACCAGAGAAGG - Intronic
1103413592 12:120729620-120729642 GACAGGGAGACCAGCACCGAGGG - Intronic
1103862825 12:124027946-124027968 GCCAGGGACTCCAGGGGAGCCGG + Intronic
1104406560 12:128522406-128522428 TCTAGGGACAACTGCAGAGAAGG - Intronic
1104719989 12:131039907-131039929 GGCAGGGCCACCAGCACAGCTGG - Intronic
1104900778 12:132188584-132188606 GCCATGGTCACCAGCAGGGCTGG - Intergenic
1104974465 12:132546266-132546288 CCCAGGGCCACCAGCAAAGCTGG + Intronic
1105278466 13:18949564-18949586 GCCAGGGACACCCACTGCGAGGG + Intergenic
1105899757 13:24744522-24744544 GACAGGCACACCAGCACCGAGGG - Intergenic
1106451794 13:29888930-29888952 GCCAGGGTCACCAGCAGCATGGG - Intergenic
1107564731 13:41590176-41590198 CCCATGGGCAACAGCAGAGAGGG - Intronic
1109201874 13:59440074-59440096 GCCAGGTACCCCAGCAGTGCCGG + Intergenic
1112326409 13:98445150-98445172 GCCAGGGGCACCCAGAGAGATGG + Intronic
1114454710 14:22847152-22847174 GCCAGAGAAAGGAGCAGAGAAGG + Exonic
1115507264 14:34104333-34104355 GCCAGGGACATGGGTAGAGAAGG - Intronic
1118458080 14:65962786-65962808 GCCTGAGACACCTGGAGAGACGG - Intronic
1119173872 14:72555034-72555056 GCCAGGAACACCAGCAGGGAGGG + Intronic
1120338670 14:83190681-83190703 CCCAGCGAGACCAACAGAGAAGG - Intergenic
1121028168 14:90632100-90632122 CCCAGGGATACCAGTAGGGAGGG - Intronic
1121190165 14:92020591-92020613 CTCAGGGACTCCAGAAGAGAAGG + Intronic
1121312196 14:92941201-92941223 GCCATGGAGACCAACAGACAGGG + Exonic
1122171109 14:99876467-99876489 AGCAGCGACACCAGGAGAGAAGG - Intronic
1122406183 14:101502416-101502438 GCCACGGGCTCCAGCAGAGCAGG + Intergenic
1122723239 14:103734160-103734182 GGCAGGGAGATCGGCAGAGAGGG + Exonic
1122796419 14:104208400-104208422 AGCCGGGACACCAGCAGAGCCGG + Intergenic
1122796466 14:104208604-104208626 GGCCGGGACACCACCAGAGCCGG + Intergenic
1122796504 14:104208791-104208813 AGCCGGGACACCAGCAGAGCCGG + Intergenic
1122796522 14:104208859-104208881 GGCCGGGACACCAGCAGAGCCGG + Intergenic
1122796549 14:104208961-104208983 GGCCGGGACACCACCAGAGCCGG + Intergenic
1122848240 14:104512483-104512505 GCCAAGGACATCAAGAGAGAAGG + Intronic
1124232140 15:27954880-27954902 GTCAGGGACACCCGCTCAGAGGG + Intronic
1125956900 15:43796746-43796768 GGAAGGGACAACAGAAGAGATGG + Exonic
1126667018 15:51084645-51084667 GTCAAGGCCACCAGCAGAGTTGG + Intronic
1126703282 15:51386029-51386051 GCAGAGGACAGCAGCAGAGAAGG + Intronic
1126782475 15:52150444-52150466 GCCAGGGACAGCTGCGGAGGGGG + Intronic
1127537301 15:59902207-59902229 GCAGTGGACAGCAGCAGAGAGGG + Intergenic
1127828990 15:62733182-62733204 GGCAGGGAAACCAGGAGAGAGGG + Intronic
1127864029 15:63017144-63017166 GACAGGGATACCAGCAGGCAAGG + Intergenic
1128094970 15:64947293-64947315 CCCAGGCACCCCAGCAGAGGTGG + Intronic
1128335681 15:66784397-66784419 GCCAGGGAGACAAGCAGACCTGG + Intergenic
1128510386 15:68310714-68310736 GCCAGGCAAACGAGCAGAAAGGG - Intronic
1129154070 15:73706847-73706869 TCCAGGGACACCACCAGTTAAGG + Intronic
1129739579 15:77983768-77983790 GGCAGAGCCACCAGCAGAGGGGG + Intergenic
1129846327 15:78769279-78769301 GGCAGAGCCACCAGCAGAGGGGG - Intronic
1130023721 15:80252185-80252207 GCCCGGGCCAGCAGCCGAGAGGG + Intergenic
1130061150 15:80570975-80570997 ACCAGGGCCATCAGCACAGACGG + Intronic
1130255963 15:82326217-82326239 GACAGGCTCACCAGCAGGGAGGG - Intergenic
1130545886 15:84857517-84857539 ACCATGGCCACCAGCAGTGAGGG + Exonic
1130598992 15:85263769-85263791 GGCAGGCTCACCAGCAGGGAGGG + Intergenic
1132661250 16:1062478-1062500 GCCGGGAACAGCAGCAGTGATGG + Intergenic
1132688396 16:1171717-1171739 TCCAGGGACTCCAGGAGGGAGGG - Intronic
1133129411 16:3667250-3667272 GACAGGGACACCCGCAGAAGAGG + Intronic
1133216272 16:4294291-4294313 GCCCAGGCAACCAGCAGAGAAGG + Intergenic
1134359482 16:13517955-13517977 GCCATGGAGACCAGAAGAGCAGG - Intergenic
1135259552 16:20969146-20969168 GACAGGGGGACCAGGAGAGAAGG - Intronic
1135931666 16:26743329-26743351 GTCAGGTCCACCCGCAGAGAAGG + Intergenic
1136081131 16:27853253-27853275 GCCAGGTACACCTGCACATAAGG + Intronic
1136385761 16:29925222-29925244 GCCAGGGACACCAGAGTGGAGGG - Intronic
1137625671 16:49906671-49906693 GCCAGGTTCACCTGCAGAGCTGG - Intergenic
1137923904 16:52521367-52521389 GCCAGGGACATGAGCAAACATGG - Intronic
1139364760 16:66426779-66426801 GCCACTGACACGTGCAGAGAAGG - Intergenic
1140240228 16:73193444-73193466 GCCAGGGGCAGCAGCAGAGCTGG - Intergenic
1140855897 16:78977519-78977541 GACAAGGACACATGCAGAGAGGG - Intronic
1142635786 17:1256781-1256803 GCCAGGAAAACAAGCAGAAATGG + Intergenic
1143012459 17:3873380-3873402 GCCAGGGATGCCAGCAGAGCTGG - Intronic
1143361882 17:6377594-6377616 GCCTGGGACACCAACAGAGCTGG + Intergenic
1143564804 17:7715080-7715102 GCCAGGGTCCCCAGGGGAGATGG + Intergenic
1144707331 17:17378184-17378206 GCCTGGCTAACCAGCAGAGAGGG - Intergenic
1145286956 17:21512952-21512974 GCCAGGGACAGCTGCCGAGCAGG - Intergenic
1145980037 17:29005820-29005842 GCCAGGAGCGCCAGCAGCGAGGG + Exonic
1146193351 17:30789905-30789927 ACAAGGGACATAAGCAGAGAAGG + Intronic
1147420994 17:40322141-40322163 GTCTGGGACATCTGCAGAGAAGG + Intronic
1148208129 17:45792284-45792306 GCAAGGGACAGGAGCAGAGTTGG - Intronic
1148321679 17:46759656-46759678 CCCAGGGCCACCAGGGGAGACGG + Intergenic
1148817558 17:50340986-50341008 TCCAGGGAGCCCAGCAGAGGAGG + Intergenic
1151351633 17:73535347-73535369 GTCAGCGACACCAGGAGGGAGGG - Intronic
1151675868 17:75597039-75597061 GCCTGGGACAGCAGCAGCGAAGG + Intergenic
1151893058 17:76962547-76962569 GCCATGGCCACCAGCAGAGAGGG + Intergenic
1152200056 17:78940012-78940034 GCCTGGGACCCCAGCAGAAATGG + Intergenic
1152335059 17:79695945-79695967 GCCAAGGACAACAGCAGGGCTGG - Intergenic
1152336848 17:79703583-79703605 GCCAGTGGCACCTGCAGAGCCGG + Intergenic
1152597739 17:81246152-81246174 GGCAGGGCCAGGAGCAGAGACGG - Exonic
1152600260 17:81258740-81258762 GCCTGGGGCACCAGCTGAGGTGG + Intronic
1152906757 17:82974662-82974684 GCCAGGGACACCCGCTGTGGGGG - Intronic
1153519515 18:5938518-5938540 GCCAGGGAGGCCAGCAGACACGG + Intergenic
1154277209 18:12972574-12972596 GGCAGGGCCAGCAGTAGAGAAGG + Intronic
1155163650 18:23215644-23215666 GCCCGGGACAAAGGCAGAGAAGG + Intronic
1155498620 18:26465790-26465812 GCCAGAGACACCATCGGAGATGG + Intronic
1155781655 18:29844974-29844996 GCCAGGGACACCAATAAAGGGGG + Intergenic
1156177707 18:34566227-34566249 AATAGGGAAACCAGCAGAGAAGG + Intronic
1156369972 18:36464668-36464690 GCCAGAGACACAGTCAGAGAGGG + Intronic
1156500327 18:37553664-37553686 GCCTGGGACACCAGCAAAACAGG - Intronic
1158640077 18:59196207-59196229 TCCAAAGACACCAGCAGAGGGGG + Intergenic
1159849823 18:73514648-73514670 GCCAGGCACACCAGCTGTGGAGG + Intergenic
1159941955 18:74415100-74415122 ACCAAAGACAACAGCAGAGAGGG - Intergenic
1160531296 18:79566405-79566427 GCGAGGGACCACCGCAGAGACGG + Intergenic
1160585645 18:79911928-79911950 GGAGGGGACAGCAGCAGAGAGGG + Intronic
1161115456 19:2494326-2494348 GCCACGGGCACCGGGAGAGAGGG + Intergenic
1161277838 19:3428758-3428780 GCCAGGGAGTCCCCCAGAGATGG + Intronic
1161728779 19:5946259-5946281 ACCCGGGACACCTGCACAGAAGG + Intronic
1162034351 19:7931358-7931380 GGCACTGACACCAGCAGGGACGG - Intronic
1163183308 19:15618913-15618935 GCCAGGGAGAGCAGCAGAAGGGG + Intronic
1163300940 19:16445766-16445788 GCCCGAGGCAACAGCAGAGAGGG + Intronic
1163387891 19:17011386-17011408 GCCAGGGCCACCATCGGAAACGG - Intronic
1164042911 19:21509581-21509603 GGCAGGGACACCTGCAGGGGAGG - Intronic
1164830948 19:31320364-31320386 GCCACGGGCAACAGCAGGGATGG - Intronic
1165393839 19:35553228-35553250 GACAGGGACACAGGAAGAGAGGG + Intronic
1165763694 19:38336998-38337020 GCCAGGAACAAGAGCAGAGGCGG + Intronic
1166194769 19:41198476-41198498 GCCTGGGCCAGCAGCAGGGAGGG - Exonic
1166304174 19:41928269-41928291 GACGGGGAGACGAGCAGAGACGG + Intronic
1166777553 19:45322173-45322195 GCCAGGGACACCCCAGGAGAGGG + Intronic
1166782135 19:45348397-45348419 ACCAGGGACCCCAACAGAGCAGG + Intronic
1166824757 19:45601942-45601964 GCCAGGGAGAGCAACAGAGGGGG + Intronic
1167111681 19:47466279-47466301 GACAGCGACACCAGCACAGGGGG - Exonic
1167528314 19:49999441-49999463 GCTGGGGACATCTGCAGAGATGG - Intronic
1167642031 19:50687316-50687338 GACAGAGAGACCCGCAGAGAGGG + Intronic
926636255 2:15182718-15182740 GCCATGGATACAAGCTGAGAAGG + Intronic
927515572 2:23669930-23669952 GGTAGGGACCCAAGCAGAGAGGG + Intronic
927636665 2:24821691-24821713 GCCAGGGAAGGCAGCAGAGCAGG - Exonic
927865567 2:26585240-26585262 GCCAGGGACGGCGGCAGAGATGG + Intronic
928016644 2:27663981-27664003 GCTGGGGACACCGGCAGAGCTGG - Exonic
928932202 2:36636353-36636375 GACAGGGACAGCACCATAGAGGG + Intronic
929576258 2:43054748-43054770 GCCAGGTGCCCTAGCAGAGAGGG - Intergenic
931526278 2:63158469-63158491 ACTTGGGACACCAGCAAAGAAGG - Intronic
931570884 2:63668190-63668212 GCCAGGGACTCCTGCAAAGGAGG - Intronic
931748341 2:65309856-65309878 GTCAAGGCCACCAGCAGGGAAGG + Intergenic
931988235 2:67761880-67761902 GTCAGGGACCCCAGAGGAGAGGG - Intergenic
932249806 2:70232888-70232910 ACCTGGAACACCAGCAGAAAAGG - Intronic
932288479 2:70555298-70555320 GACAGGGAAACCACCAGAGCAGG - Intergenic
933854399 2:86399398-86399420 GCCAGAGAAAGAAGCAGAGAAGG + Intergenic
933976338 2:87514997-87515019 GACAGCCACACCTGCAGAGAGGG + Intergenic
933994505 2:87658031-87658053 CTCAGGAACACCAGCAGAGCCGG + Intergenic
934038847 2:88110983-88111005 CCCAGAGACACCTGCACAGATGG - Exonic
935140015 2:100344733-100344755 GCCCGTGAAAGCAGCAGAGAGGG + Intergenic
936165357 2:110115647-110115669 ACCCGGGCCACCTGCAGAGAGGG - Intronic
936299353 2:111292882-111292904 CTCAGGAACACCAGCAGAGCCGG - Intergenic
936317483 2:111435809-111435831 GACAGCCACACCTGCAGAGAGGG - Intergenic
937484176 2:122296847-122296869 TCCAGGCACATCAGCTGAGAGGG - Intergenic
937637278 2:124170462-124170484 TCTTGGGACATCAGCAGAGATGG + Intronic
938009162 2:127814613-127814635 GCCAAGCACATCAGCAGAAATGG + Intergenic
942452602 2:176117618-176117640 GCCCGGGAACCCGGCAGAGAGGG + Intronic
942481758 2:176395589-176395611 GCCAGGGGTACAGGCAGAGAGGG - Intergenic
942851605 2:180494407-180494429 ACCAGGAACACCAACACAGAAGG - Intergenic
943944116 2:194036523-194036545 GCTAGGGAAGCCAGCAGAAATGG + Intergenic
946426679 2:219602155-219602177 GGCAGGGAGAGCTGCAGAGAGGG - Intronic
947857710 2:233335326-233335348 CCCAGGGTCAGCAGCAGAGCTGG - Intronic
948056888 2:235015420-235015442 GGGAGGGACAACAGCAGCGAGGG - Intronic
948701076 2:239760743-239760765 GCCGGGGACACCAGCAGGGAGGG + Intergenic
948835542 2:240624419-240624441 GCCCGGGATGACAGCAGAGAAGG + Intronic
948844901 2:240678416-240678438 GCCAGGGGAACCGGCAGACATGG + Intronic
948848959 2:240696463-240696485 GCCAGGGGAACCGGCAGACATGG - Intronic
949045978 2:241872826-241872848 GCCTTGGACATCAGCAGGGAAGG - Exonic
1168938688 20:1690659-1690681 CCCAGTGAGACCAACAGAGAAGG + Intergenic
1169275303 20:4229780-4229802 GGCAGGGGCACAAGCAGTGAGGG - Intronic
1169400520 20:5275389-5275411 GCCTGGGTCACCAGCAGTGAAGG - Intergenic
1170158718 20:13291490-13291512 GTCAGGGAAACCAGCAGGGAAGG + Intronic
1171446485 20:25207833-25207855 GCCAGGGGCAACAGCCGAGAGGG + Intronic
1171797306 20:29576570-29576592 GCCTGGGACACCAGCTTAGGGGG - Intergenic
1171850946 20:30307591-30307613 GCCTGGGACACCAGCTTAGTGGG + Intergenic
1171962405 20:31504192-31504214 GGCTGGGACACCAGTAGAGACGG - Intergenic
1172314191 20:33940841-33940863 GCCCAGGACACCTGCAGAGAGGG - Intergenic
1173225113 20:41158002-41158024 GTCAGGGAAAACAGCAGAAAAGG + Intronic
1173549555 20:43923164-43923186 AGTTGGGACACCAGCAGAGATGG + Intronic
1175371481 20:58495857-58495879 GCCAGGGCCATCAGCGGAGTGGG + Intronic
1176375548 21:6085390-6085412 GGCAGGGCCAGAAGCAGAGACGG - Intergenic
1177788742 21:25698996-25699018 GGCAGGGGCACCAGGAAAGATGG + Intronic
1178132660 21:29590847-29590869 GCAAGGGAGACCAGCTGGGAGGG + Intronic
1178545688 21:33491493-33491515 GGGAGGGACACCCGCAGTGAAGG - Intronic
1179747926 21:43452854-43452876 GGCAGGGCCAGAAGCAGAGACGG + Intergenic
1179897398 21:44370307-44370329 GCCAGGGACCACAGCACAGTGGG - Intronic
1181035821 22:20169359-20169381 GCCCGGGCCCCCAGGAGAGAGGG + Intergenic
1181815853 22:25436445-25436467 TCCAGGGACTGCAGCAGGGATGG - Intergenic
1182360617 22:29744435-29744457 GCCAGGGGGACCAGCAGGGTGGG + Intronic
1182483675 22:30626571-30626593 TCCAGGGACATCAGGAGGGAGGG - Exonic
1182585426 22:31341971-31341993 TTCAGGGAGACCAGCAGGGAGGG - Intronic
1183012819 22:34961307-34961329 GCCACGGACATGAGCAGGGAGGG + Intergenic
1183094547 22:35544271-35544293 GCCTGGGCCTTCAGCAGAGATGG - Intronic
1183205661 22:36417231-36417253 GCCAGGGACACAGGCAGCAAGGG + Intergenic
1184118055 22:42433339-42433361 TGAAGGGACACCTGCAGAGAAGG - Intergenic
1184177178 22:42795005-42795027 GGCAGAGCCACCAGCAGAGGGGG - Intergenic
1184297584 22:43534957-43534979 GCCAGGGCCTGAAGCAGAGAAGG - Intronic
1184379566 22:44136591-44136613 GCCAGGGACACCAGCGCCCATGG + Intronic
1184853838 22:47135971-47135993 GCCAGGGACACCGGTTGAGGAGG + Intronic
1185091662 22:48778965-48778987 GCCAGGGACACCAGCCCACCAGG + Intronic
1185098256 22:48823195-48823217 GCCAGGGAGGACAGCAGGGATGG - Intronic
950032057 3:9859920-9859942 CCCTGGGGAACCAGCAGAGAGGG + Intergenic
950154137 3:10709126-10709148 GCCAGGGAGGCCAGTGGAGAAGG + Intergenic
950243652 3:11394886-11394908 ACCAGGCACACAAGAAGAGAAGG + Intronic
950451154 3:13066619-13066641 GCCAGGAGGACCAGGAGAGAGGG + Intronic
952119646 3:30226952-30226974 GGCAGGGCCACCAGCAGAGGTGG - Intergenic
953177908 3:40568498-40568520 GATAGGGAGAGCAGCAGAGATGG + Intronic
953723113 3:45373510-45373532 GCAAAGGAGACAAGCAGAGAAGG + Intergenic
953879690 3:46685278-46685300 ACCAAGGACACCAGCTGGGAAGG + Intronic
953923901 3:46970949-46970971 GCCAGGGTTTCCAGCAGGGATGG - Intronic
954579726 3:51696701-51696723 GCCAGGCCCACAGGCAGAGAAGG - Intronic
954647274 3:52139387-52139409 GTGAGGGACACCAGAAAAGATGG - Intronic
954850242 3:53593858-53593880 GCTTGGGTCACCAGCGGAGATGG + Intronic
955141606 3:56275320-56275342 GCCAATGAAAACAGCAGAGAGGG + Intronic
955349520 3:58183513-58183535 TCCAGGGACAACAGGAGAAATGG + Intergenic
955422641 3:58754298-58754320 GCCATGGACCCCAGCAGTGGTGG + Intronic
956355617 3:68389607-68389629 CCCAGCAACAACAGCAGAGAAGG + Intronic
957884216 3:86263237-86263259 GCCAGTGACACCCGCAGACAGGG - Intergenic
961034673 3:123634290-123634312 TCCAGGCTCAGCAGCAGAGAGGG + Intronic
961361469 3:126370805-126370827 GCCAGGCACACCAGAGCAGAGGG + Intergenic
962310709 3:134324898-134324920 GCCAGTGAGACCAGCAGTGATGG - Intergenic
963067567 3:141275430-141275452 GCCAGGGACAGAAGCAGCTAAGG - Intronic
967192478 3:186996858-186996880 AGCAGGGACCCAAGCAGAGAGGG - Intronic
967953365 3:194857967-194857989 ACCAGGGACCCCACCAGACATGG - Intergenic
968046606 3:195627560-195627582 GCCAGGCACACATGGAGAGATGG - Intergenic
968308047 3:197662480-197662502 GCCAGGCACACATGGAGAGATGG + Intergenic
968395482 4:232805-232827 GGCTGGGACACCTGCAGAAAAGG - Intergenic
968952312 4:3701501-3701523 GCCCAGGGCACCAGCTGAGAGGG - Intergenic
969485767 4:7471718-7471740 GCCAGGGCCAGCAGCACCGAGGG - Intronic
969588705 4:8109162-8109184 GCCAGGCAGACCAGAAGAGGGGG - Intronic
970425362 4:15940851-15940873 GCCAATGACACCAACAGAGAGGG - Intergenic
970463920 4:16304346-16304368 GCCAATGGCACCAACAGAGAGGG + Intergenic
972075431 4:35080188-35080210 GCCAGGCACACCAGCTGCTATGG - Intergenic
972318861 4:37953795-37953817 GCCAGGGACAGCAGAAAATAAGG + Intronic
973193722 4:47415876-47415898 GCCAAGGACACCTGCAGAGGTGG - Intronic
973605352 4:52581628-52581650 GCCAGGGACCCACTCAGAGAGGG - Intergenic
974549241 4:63349685-63349707 GCCAAGGCCACCACCAGCGAGGG + Intergenic
974965100 4:68750779-68750801 GACAGGGACATGAGCAAAGAAGG - Intergenic
975415554 4:74100098-74100120 GCCATAGACACCACCAGAAAAGG + Intergenic
975691849 4:76973216-76973238 AGCAGGGACCCCAGGAGAGATGG - Intronic
979439213 4:120731411-120731433 GCCAGGCAGTACAGCAGAGAAGG + Intronic
980931269 4:139185311-139185333 GTCAGTGTCACCAGCAGATATGG - Intergenic
981171978 4:141636321-141636343 TGCCGGGACACCTGCAGAGAAGG - Intergenic
983661684 4:170135572-170135594 GCCACAGACACGAGCAGAGCTGG - Intergenic
984818208 4:183857722-183857744 GACAGGGACACCAGCAGCACTGG - Intronic
985576641 5:676327-676349 GCCACGGAGCACAGCAGAGACGG + Intronic
985745028 5:1641623-1641645 GCCAGGCACACATGGAGAGATGG + Intergenic
986312009 5:6557766-6557788 GTCAGGGGGACCAGCACAGATGG - Intergenic
988662406 5:33286008-33286030 GCTAGGGACACCAGAATTGAAGG - Intergenic
988779737 5:34509500-34509522 CCCCGGGACACCAGCTGAAATGG + Intergenic
989339278 5:40355342-40355364 GCCAGGCACACCAGCTGTGGTGG - Intergenic
990731851 5:58817124-58817146 GCAAGGTACACCTGCAGGGAAGG + Intronic
990770326 5:59236682-59236704 GGCAGGGACACCACCAAGGAAGG - Intronic
991301933 5:65136991-65137013 GCCAGGGACACATGCAGAAGAGG - Intergenic
992462554 5:76975196-76975218 GCCAAAGACACCAGCACAGCAGG + Intronic
993225967 5:85167513-85167535 GCCTGTGAAAACAGCAGAGAGGG + Intergenic
993873544 5:93279702-93279724 GGCAGGGAGAGGAGCAGAGAGGG - Intergenic
995451271 5:112303847-112303869 GCCAAAGACAGCAGCAGATAAGG + Intronic
997281811 5:132653688-132653710 ACCAAGGACATCAGAAGAGAAGG + Intergenic
998131065 5:139651254-139651276 GCCAGGGTCACCTGCTGAGCGGG - Intronic
998145642 5:139726501-139726523 GACAGGGACACAAGCAAAGCTGG - Intergenic
998462405 5:142319562-142319584 GCCAGGGACCCCATCAATGAAGG - Intronic
998494579 5:142576548-142576570 GCCAAGGATTTCAGCAGAGATGG + Intergenic
999582146 5:153050705-153050727 CCCAGGAATACAAGCAGAGAAGG - Intergenic
1001085637 5:168698472-168698494 GCCAGGAACACCAGAAGCCAGGG + Intronic
1001311091 5:170611591-170611613 GCTATGGACTCCAGGAGAGAGGG - Intronic
1001703988 5:173728735-173728757 GCCAGGGATACAGACAGAGATGG + Intergenic
1002134798 5:177100895-177100917 GCCAGGGACGCTGGCAGGGAGGG - Intergenic
1002212702 5:177608203-177608225 GGCAGGGCCACCAGGAGAAAGGG + Intronic
1002644155 5:180645064-180645086 GCCTGGGACTCCAGCAGGAAGGG + Intronic
1003097640 6:3155251-3155273 GGCAGTGTGACCAGCAGAGAAGG + Intronic
1003361042 6:5425528-5425550 GCCAGGGACACTTGCAGGGCGGG - Intronic
1003973465 6:11321285-11321307 GCGAAGGCCACCAGCAGCGATGG + Intronic
1005116555 6:22344939-22344961 CCCAGGGAGACCAGCATTGAAGG - Intergenic
1005120063 6:22379833-22379855 GGCAATGACACCAGGAGAGAAGG + Intergenic
1005450002 6:25963149-25963171 AGCAGTGACCCCAGCAGAGAGGG + Exonic
1007091242 6:39186080-39186102 GGCAGGGAGACCAGCAGATGGGG + Intergenic
1007392483 6:41558072-41558094 GCCAGGAACTCAGGCAGAGATGG + Intronic
1007498172 6:42276148-42276170 GCCTGGGGCACCAGGAGACAAGG + Intronic
1009718353 6:67428776-67428798 CCCAGTGAGACCAACAGAGAAGG - Intergenic
1011245891 6:85320958-85320980 CCCAGGGTCAGCTGCAGAGAAGG + Intergenic
1013255223 6:108378753-108378775 GCCAGGGTCTCCAGATGAGAAGG - Intronic
1013517675 6:110903321-110903343 GTCAGGGACACGAGGAGACAAGG - Intergenic
1014391822 6:120873335-120873357 GCCAGGCACACCAGCTGCCATGG - Intergenic
1015536276 6:134270599-134270621 CCCAAGGACAACAGCATAGAAGG - Intronic
1016539293 6:145145502-145145524 TCCAGGGACTCCAGTGGAGATGG + Intergenic
1017753865 6:157513131-157513153 GCCCAGGACACCAGGGGAGATGG + Intronic
1018711418 6:166500441-166500463 GGCAGGGACAGCATCAGTGAGGG + Intronic
1019291055 7:250491-250513 GCCAGGCACACCTCCAGTGATGG + Intronic
1019742759 7:2682892-2682914 GCCCGGGTCAACGGCAGAGATGG - Intronic
1019775512 7:2909878-2909900 GCCAAGGACAGCGGCCGAGATGG - Intronic
1020081886 7:5290704-5290726 GCCAGAGACACCAGGTGAGACGG - Intronic
1020378672 7:7517210-7517232 TCCAGGGGGACAAGCAGAGAGGG + Intronic
1022750679 7:33221092-33221114 GAAAGTGACACCAGCAGAGCTGG - Intronic
1023881421 7:44323674-44323696 ACCAGGGACACCTGCTGTGAGGG + Intronic
1023941148 7:44769057-44769079 CCCAGGGACAAGAGCTGAGAAGG - Exonic
1024569427 7:50711403-50711425 GCCAGGGACATCAGCTGAGACGG + Intronic
1026415763 7:70179008-70179030 GCCAGGGTAAACAGAAGAGAAGG - Intronic
1026977081 7:74505508-74505530 ACCAGGGACTCCAGGAGGGAGGG - Intronic
1027843254 7:83341361-83341383 GCCAGAGAGATCAACAGAGAAGG + Intergenic
1028432542 7:90763863-90763885 GCCAGGTACACTAGGACAGAAGG - Intronic
1029258496 7:99285517-99285539 GCTAAGGAAACCAGTAGAGAAGG + Intergenic
1029914945 7:104199294-104199316 GCCTGTGAAAACAGCAGAGAGGG + Intronic
1030131755 7:106207453-106207475 GCCAGGGCCAGGAGGAGAGATGG - Intergenic
1031570753 7:123356372-123356394 ACCAGGGATAGCAGCAGACAGGG - Intergenic
1031858977 7:126957338-126957360 GGCAGGGACACCAGCTGAGTGGG + Intronic
1032308225 7:130756460-130756482 GCCAGGGATATCAGGAGATAAGG - Intergenic
1032428819 7:131843901-131843923 GCCTGGGACACGGGGAGAGATGG - Intergenic
1032430732 7:131859245-131859267 GCCATGGACACCTGGAGAGAGGG + Intergenic
1032478319 7:132227183-132227205 GCAAGGAACAGCTGCAGAGAGGG - Intronic
1032859220 7:135861746-135861768 CCCTGGGACAGCAGCAGAGGTGG - Intergenic
1034215762 7:149404610-149404632 GCCAGGCACACCAGCTGCTATGG + Intergenic
1034295923 7:149972468-149972490 GCCAGGGACTGATGCAGAGAGGG - Intergenic
1034429244 7:151032904-151032926 GCCTGGGACATCAGAAGACATGG + Intronic
1034628809 7:152514783-152514805 GCCAGGGACACCTGCTGCGTGGG + Intergenic
1034810128 7:154124434-154124456 GCCAGGGACTGATGCAGAGAGGG + Intronic
1035272313 7:157727810-157727832 GGCAGGGCCAGCAGCAGAGCTGG - Intronic
1036547704 8:9788093-9788115 GGCAGGGCCAGAAGCAGAGAGGG + Intergenic
1037285578 8:17294825-17294847 CCCAGGGAGACCAACAGAGAAGG - Intronic
1039423726 8:37467943-37467965 GCCAGGGAGAGCAGGTGAGAAGG + Intergenic
1039612876 8:38932987-38933009 GCCAGGGAGGCCAGGACAGAGGG + Intronic
1042745269 8:72100117-72100139 GGCAGGGACCTCAGCACAGAAGG - Intronic
1042975741 8:74467154-74467176 GAGAGGGACAGCAGTAGAGAAGG + Intronic
1043595659 8:81881929-81881951 TCCTGGTAAACCAGCAGAGAAGG + Intergenic
1043803522 8:84642701-84642723 TCCAGGGACACCAGCCCTGAAGG - Intronic
1044587561 8:93882214-93882236 TCCAGGGAAACCAGTGGAGAAGG - Intronic
1044804091 8:95987282-95987304 GCCTGGAACACCCACAGAGATGG - Intergenic
1045094564 8:98784495-98784517 GCCAGGGAGTAGAGCAGAGAGGG - Intronic
1045429707 8:102102460-102102482 GGCAGGGACACCAGAGGACATGG + Intronic
1046836645 8:118809140-118809162 GGCAGGGATCCCAGCAGATAAGG - Intergenic
1047369688 8:124245941-124245963 CCCAGTGAGACCAGCACAGAAGG - Intergenic
1048268837 8:133011888-133011910 TCCAGAGACACTAGGAGAGAAGG - Exonic
1048886671 8:138914702-138914724 GCCAGCGCCCCCAGCAGAGCAGG + Intergenic
1048961800 8:139585933-139585955 GCCAGAGACACCTGCAGGTAAGG - Intergenic
1049204660 8:141358119-141358141 GCCTCGGACAGCAGCAGAAAAGG + Intronic
1049215709 8:141407024-141407046 TCCAGGATCCCCAGCAGAGAGGG - Intronic
1049572365 8:143375255-143375277 GCCAAGGACACCAGAAGCCAGGG - Intronic
1049973611 9:841977-841999 GCCGGGGGCAGCAGCAGAGGAGG + Exonic
1051214269 9:14779470-14779492 GCCAGGGACTCCATCAGAGGCGG + Intronic
1051261349 9:15268368-15268390 GGCAGGGAGACGAGCTGAGAGGG - Intronic
1051899954 9:22026618-22026640 TCCAGCGAGATCAGCAGAGAAGG - Intronic
1052384306 9:27806493-27806515 GAGAGGGGTACCAGCAGAGAGGG + Intergenic
1056411729 9:86334797-86334819 ACCAGGGCCACCAGAAGATAAGG - Intronic
1057310427 9:93939592-93939614 ACAAGGGACCCCAGAAGAGAGGG + Intergenic
1058562409 9:106243958-106243980 GTCAGGCACACAGGCAGAGAAGG - Intergenic
1058732087 9:107860110-107860132 ACCAGCATCACCAGCAGAGAGGG + Intergenic
1059196673 9:112377060-112377082 GCCAGGGACACAAGTGGATATGG - Intergenic
1059341986 9:113602462-113602484 GCCAAGGACCAGAGCAGAGAGGG - Intergenic
1059487709 9:114639560-114639582 GTCAGGGAGACAAGCAGTGATGG + Intronic
1060684774 9:125599267-125599289 GACAGGGACATCATCAGTGAAGG - Intronic
1060816523 9:126638175-126638197 GCCAGGGACACCAGCAGAGAGGG - Intronic
1060952252 9:127611975-127611997 GCCAGGGATCCCAGCACCGACGG + Intergenic
1061316825 9:129801632-129801654 GCCAGGAACGACAGCAGAGGAGG - Intergenic
1061411080 9:130422104-130422126 GCCAGGGCCAGCAGCACTGATGG + Intronic
1061449123 9:130659332-130659354 GCCGGGGACACCAGGAGACCGGG - Intergenic
1061881332 9:133570701-133570723 CCCAGGGACAAGATCAGAGAAGG - Intronic
1061889582 9:133610809-133610831 GCCAGGGGCCCCAGCAGGGGAGG - Intergenic
1061959987 9:133983043-133983065 GGCTGGGACACCGGCAGAGAAGG + Intronic
1062319317 9:135982689-135982711 GGCAGGGCCACCAGCACGGATGG + Intergenic
1062362038 9:136192912-136192934 GCCAGCGACGCCAGCAGAGCCGG + Intergenic
1062409964 9:136418610-136418632 GCCGGGCCCACCAGCCGAGAAGG - Exonic
1062627039 9:137448056-137448078 GCCAGGGGGACCAGCACAGGAGG - Exonic
1185487546 X:494581-494603 GCCATGGACAGGAGGAGAGAAGG - Intergenic
1185522180 X:748583-748605 GGCAGGGATACCAGATGAGAAGG + Intergenic
1185846564 X:3442900-3442922 GCCAGCAACACCAGTGGAGATGG - Intergenic
1186774959 X:12855144-12855166 CCCAGGGAGACCAACGGAGAAGG - Intergenic
1188952351 X:36391647-36391669 CCCAGGGACACCAGCAAAAATGG - Intergenic
1190708375 X:53048824-53048846 GCCAGAGGCAGCAGCAGAGGTGG - Intergenic
1193026453 X:76850817-76850839 GCCAGGGTCTCCAGATGAGAAGG - Intergenic
1195211053 X:102652369-102652391 GCCTGGAACACCATTAGAGAGGG - Intronic
1196738627 X:119004354-119004376 GTCAAGGAGACCAGCAGAAATGG - Intronic
1197490682 X:127113222-127113244 CCCAGGAACACCAGGAGAGTTGG + Intergenic
1197782462 X:130171791-130171813 GCCAGGGAGAGGAGGAGAGAGGG - Exonic
1197892820 X:131282871-131282893 GCCAGGGTTAACAGTAGAGAAGG - Intronic
1198428552 X:136543356-136543378 GCAAGTGCCACCAGCAAAGAGGG + Intronic
1198446770 X:136725156-136725178 GCCAGTGGTTCCAGCAGAGATGG - Intronic
1199199235 X:145067616-145067638 GTCAGACACAACAGCAGAGAGGG + Intergenic
1199510294 X:148614088-148614110 GCTAGGGGGACCATCAGAGATGG + Intronic
1200116656 X:153772523-153772545 GCCTGGGACAGGAGCAGTGAGGG + Intronic