ID: 1060816524

View in Genome Browser
Species Human (GRCh38)
Location 9:126638176-126638198
Sequence TGCCAGGGACACCAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060816524_1060816530 -7 Left 1060816524 9:126638176-126638198 CCTCTCTGCTGGTGTCCCTGGCA No data
Right 1060816530 9:126638192-126638214 CCTGGCAGGTGGGTCCCGACAGG 0: 1
1: 0
2: 0
3: 33
4: 145
1060816524_1060816536 8 Left 1060816524 9:126638176-126638198 CCTCTCTGCTGGTGTCCCTGGCA No data
Right 1060816536 9:126638207-126638229 CCGACAGGAATGCTCCGGTGGGG No data
1060816524_1060816534 7 Left 1060816524 9:126638176-126638198 CCTCTCTGCTGGTGTCCCTGGCA No data
Right 1060816534 9:126638206-126638228 CCCGACAGGAATGCTCCGGTGGG No data
1060816524_1060816532 6 Left 1060816524 9:126638176-126638198 CCTCTCTGCTGGTGTCCCTGGCA No data
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816524_1060816531 3 Left 1060816524 9:126638176-126638198 CCTCTCTGCTGGTGTCCCTGGCA No data
Right 1060816531 9:126638202-126638224 GGGTCCCGACAGGAATGCTCCGG No data
1060816524_1060816537 9 Left 1060816524 9:126638176-126638198 CCTCTCTGCTGGTGTCCCTGGCA No data
Right 1060816537 9:126638208-126638230 CGACAGGAATGCTCCGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060816524 Original CRISPR TGCCAGGGACACCAGCAGAG AGG (reversed) Intronic