ID: 1060816524

View in Genome Browser
Species Human (GRCh38)
Location 9:126638176-126638198
Sequence TGCCAGGGACACCAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 349}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060816524_1060816530 -7 Left 1060816524 9:126638176-126638198 CCTCTCTGCTGGTGTCCCTGGCA 0: 1
1: 0
2: 3
3: 61
4: 349
Right 1060816530 9:126638192-126638214 CCTGGCAGGTGGGTCCCGACAGG No data
1060816524_1060816532 6 Left 1060816524 9:126638176-126638198 CCTCTCTGCTGGTGTCCCTGGCA 0: 1
1: 0
2: 3
3: 61
4: 349
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816524_1060816536 8 Left 1060816524 9:126638176-126638198 CCTCTCTGCTGGTGTCCCTGGCA 0: 1
1: 0
2: 3
3: 61
4: 349
Right 1060816536 9:126638207-126638229 CCGACAGGAATGCTCCGGTGGGG No data
1060816524_1060816537 9 Left 1060816524 9:126638176-126638198 CCTCTCTGCTGGTGTCCCTGGCA 0: 1
1: 0
2: 3
3: 61
4: 349
Right 1060816537 9:126638208-126638230 CGACAGGAATGCTCCGGTGGGGG No data
1060816524_1060816531 3 Left 1060816524 9:126638176-126638198 CCTCTCTGCTGGTGTCCCTGGCA 0: 1
1: 0
2: 3
3: 61
4: 349
Right 1060816531 9:126638202-126638224 GGGTCCCGACAGGAATGCTCCGG No data
1060816524_1060816534 7 Left 1060816524 9:126638176-126638198 CCTCTCTGCTGGTGTCCCTGGCA 0: 1
1: 0
2: 3
3: 61
4: 349
Right 1060816534 9:126638206-126638228 CCCGACAGGAATGCTCCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060816524 Original CRISPR TGCCAGGGACACCAGCAGAG AGG (reversed) Intronic
900867437 1:5278352-5278374 TGCCATGGACAGCATCAGAACGG - Intergenic
900972765 1:6000596-6000618 TGTCACTCACACCAGCAGAGCGG - Intronic
901036491 1:6339064-6339086 GGGCAGGGAGACCTGCAGAGGGG + Intronic
901071270 1:6519968-6519990 AGCCAAGGAGCCCAGCAGAGGGG - Intronic
901438550 1:9263953-9263975 GGCCAGGCTCTCCAGCAGAGGGG - Exonic
901778876 1:11579541-11579563 TGCCTGGGAAGCCTGCAGAGGGG - Intergenic
902410339 1:16208277-16208299 GGCCAGGGGCAGCAGCAGGGAGG - Intronic
902850040 1:19148074-19148096 TGGCAGGGACAACAGCAAAGTGG + Exonic
903066771 1:20704121-20704143 TGCCACAGACAGCAGCAGACGGG + Intronic
903068327 1:20713701-20713723 TGCCAGGAAGGCCAGCAGGGCGG - Intronic
904755608 1:32766910-32766932 GGCCAGGGCCTCCAGGAGAGGGG + Intronic
905168724 1:36098196-36098218 TGCCAGGGCCCCCTGGAGAGGGG - Exonic
905671187 1:39791306-39791328 TGCAAGTTACAACAGCAGAGAGG - Intergenic
906321500 1:44820287-44820309 TCCCAGGAGGACCAGCAGAGAGG - Intronic
906458704 1:46020973-46020995 AGCCAGGGACATCAGGGGAGAGG + Intronic
906544798 1:46613373-46613395 TGCCAGGGACAAGGGCATAGGGG + Intronic
907372853 1:54014294-54014316 TGCCAGGAGGAGCAGCAGAGAGG + Exonic
909632350 1:77780099-77780121 TGCCAAGAACACCAGAAAAGGGG - Intronic
911874219 1:103138075-103138097 TGCCAGGGGTACCAGCAGAGAGG - Intergenic
912775354 1:112503185-112503207 TCCCAGGGACTCCAGTGGAGTGG - Intronic
913467695 1:119159177-119159199 AGGCGGGGACACCAGGAGAGAGG - Intergenic
914825341 1:151135178-151135200 TGCCGGGCACACCGGCTGAGAGG + Exonic
917605187 1:176620962-176620984 TGCCAGAGATACCAGCAAAGAGG + Intronic
918382380 1:183969100-183969122 TCCCAGGGACAGCAACATAGAGG + Intronic
918695216 1:187537723-187537745 TTCTAGGGACAGCAGCAAAGGGG + Intergenic
920691335 1:208148756-208148778 TCCCAGGGAGACCAGCACGGGGG + Intronic
922742193 1:228020306-228020328 ACCCAGGAACGCCAGCAGAGGGG - Intronic
1063377326 10:5562003-5562025 GGCGGGGGACACCAGGAGAGGGG - Intergenic
1063410703 10:5834462-5834484 TGCTCAGGACACAAGCAGAGTGG + Intronic
1065125286 10:22568071-22568093 GGCCAGGAATACCTGCAGAGAGG - Intronic
1065665624 10:28057187-28057209 GACCTGGGACACCAGCAGAGAGG + Intronic
1066602553 10:37124676-37124698 TGTCAGCGTCACCAGCAGCGCGG + Intergenic
1066602669 10:37125247-37125269 TGTCAGCGTCACCAGCAGCGCGG + Intergenic
1067318889 10:45198825-45198847 TGTCAGCGCCACCAGCAGCGCGG - Intergenic
1067796561 10:49325857-49325879 TGCCAGGGTCACCCGGAGGGAGG + Exonic
1068928350 10:62563276-62563298 TGCCCAGATCACCAGCAGAGAGG + Intronic
1068982239 10:63073810-63073832 TGTCAGGCACACCAGCATATAGG + Intergenic
1069126142 10:64636772-64636794 TGACAGTGACATCAGCAAAGTGG - Intergenic
1069999479 10:72365652-72365674 TACCAGGGACACCCCAAGAGGGG + Intergenic
1070762116 10:79030321-79030343 TCCCATGATCACCAGCAGAGAGG - Intergenic
1070953285 10:80447776-80447798 AGCCAGACACACCAACAGAGAGG + Intergenic
1070994023 10:80759632-80759654 TCCAAGGGACACCAGCACAAAGG - Intergenic
1072054404 10:91740251-91740273 TGCCAGCAGCACCAGCAGAATGG + Intergenic
1072924650 10:99606391-99606413 AGACAGGGACTCTAGCAGAGGGG - Intergenic
1074313982 10:112345613-112345635 TGCCAGGGCCCCCATCACAGAGG + Intergenic
1075408166 10:122208375-122208397 TGCCAGGTACTCCAGGAGAAAGG + Intronic
1075713635 10:124543560-124543582 TGCCAGGGCCACTAGCCGTGAGG + Intronic
1075917249 10:126179231-126179253 TGCCAGAGCAAACAGCAGAGGGG - Intronic
1076341933 10:129755296-129755318 TGCCAGGGACACCAGCTCCTGGG + Intronic
1076521051 10:131081644-131081666 TGTCTGGAACTCCAGCAGAGGGG + Intergenic
1076689352 10:132213372-132213394 TGACAGGGATTCCAGCAGAGAGG + Intronic
1076925428 10:133481438-133481460 ATCCATGGACAACAGCAGAGTGG + Intergenic
1077407978 11:2391158-2391180 TGCCAGGGGCACCAGGAGGAAGG - Intronic
1077889987 11:6411710-6411732 TGCCAGGAACACCACTAGAGTGG + Intronic
1078415849 11:11164130-11164152 TGCCAGGGTCACCAACAGCCCGG + Intergenic
1078539210 11:12199924-12199946 TGCCAGGGCCACCAGCATCATGG - Intronic
1078911265 11:15734653-15734675 TGCCAGGGACAATAGCTGTGGGG - Intergenic
1079005136 11:16786228-16786250 TGACTTGGACATCAGCAGAGAGG - Intronic
1079139640 11:17799468-17799490 TCCGAGGGGCACTAGCAGAGGGG + Intronic
1079929674 11:26542377-26542399 TGCTAGGGCTTCCAGCAGAGAGG + Intronic
1080052844 11:27874433-27874455 AAGCAGGGACACCAGCAAAGGGG - Intergenic
1081757622 11:45555905-45555927 TGCCAGGGACAGCAGCTGTGGGG + Intergenic
1082774853 11:57237036-57237058 TCCCAGGGACACCAGCTCCGTGG + Exonic
1082809074 11:57467732-57467754 TGGCAGGGACAGCGGCACAGAGG - Exonic
1083377071 11:62232654-62232676 TGCCAGGGACTCCAGTGGATCGG - Intergenic
1085244308 11:75086865-75086887 TGCCAGGGAGACTAGGAGAAGGG - Intergenic
1085769573 11:79312769-79312791 TGGAATGGACACCTGCAGAGTGG + Intronic
1088058151 11:105610271-105610293 TGCCAGGAAAACCAAGAGAGGGG + Exonic
1089300238 11:117494283-117494305 TTCCAGGTACAACAGCAGAGTGG - Intronic
1089611377 11:119671387-119671409 AGCCAGGGACCCCAGAAGAGAGG - Intronic
1090171752 11:124611693-124611715 TGCCAGGGACATCAGCAACAAGG - Exonic
1091331912 11:134737082-134737104 TGACAGGGACGCAGGCAGAGAGG - Intergenic
1091706252 12:2695406-2695428 GGGGAGGGACATCAGCAGAGGGG - Intronic
1091711483 12:2743636-2743658 GGGGAGGGACATCAGCAGAGGGG - Intergenic
1092112309 12:5972282-5972304 TGCCAGGGAGACCAGCATCCTGG + Intronic
1092387050 12:8043862-8043884 TGGAAGGAATACCAGCAGAGGGG + Intronic
1096106619 12:48999779-48999801 CCCCATGGAAACCAGCAGAGTGG - Intergenic
1096368003 12:51044916-51044938 TGGCAGGGAAACCAGTAAAGAGG + Intergenic
1096545427 12:52335852-52335874 TGCCAGGGTCTGCAGCTGAGCGG - Intergenic
1096607514 12:52777213-52777235 TGCCGGAGACCACAGCAGAGCGG + Exonic
1096610214 12:52795967-52795989 TGCCGGAGACCACAGCAGAGCGG + Exonic
1096799117 12:54097778-54097800 TGCCTGGGACACCAGCTTAGGGG + Intergenic
1096807665 12:54150345-54150367 TGCCAGGGGCAGGGGCAGAGAGG + Intergenic
1096982913 12:55738569-55738591 TGCCAGGGAGACTAGGACAGTGG + Intergenic
1098300197 12:69046481-69046503 TGCCATGGAAATCAGCAGATTGG + Intergenic
1099547100 12:83998070-83998092 TCCCTGGGATACCAGTAGAGTGG + Intergenic
1100111574 12:91250178-91250200 TGCCAGAGACAACAGTGGAGTGG - Intergenic
1101236558 12:102795726-102795748 TTCCAGGGGCACCAGGAGAGTGG + Intergenic
1101587893 12:106101076-106101098 TAGCAGGGAGACCAGCAGATGGG + Intronic
1102233602 12:111280388-111280410 TGCCAGTGACACCAGAAGCTGGG + Intronic
1102392155 12:112557961-112557983 TGCCAGGGACTGCAACACAGGGG - Intergenic
1102983638 12:117261936-117261958 TTCCAGGGGCACTAGCAGACAGG + Intronic
1103984106 12:124755604-124755626 GGCCAGACACCCCAGCAGAGGGG + Intergenic
1104415757 12:128595670-128595692 TGCCAGGGCCTCAGGCAGAGGGG + Intronic
1104607743 12:130202424-130202446 TGCCAGGGACCCCAGAAGCCAGG - Intergenic
1104879722 12:132062189-132062211 TGCCATGGACACCAGGTCAGGGG - Exonic
1104967898 12:132517540-132517562 TAACTGGGACAACAGCAGAGCGG + Intronic
1105223660 13:18408224-18408246 TGCCAGCGCCACCAGCCGCGCGG + Intergenic
1105239562 13:18597837-18597859 TGCCAGTGCCACCAGCAGTGCGG - Intergenic
1106170878 13:27286882-27286904 TGGAAGGTACCCCAGCAGAGGGG + Intergenic
1106451795 13:29888931-29888953 GGCCAGGGTCACCAGCAGCATGG - Intergenic
1107069448 13:36254920-36254942 TGCCAGGGCCCCCAGGAGGGAGG - Intronic
1108358605 13:49650026-49650048 TGCCTAGGACAGCAGAAGAGAGG - Intergenic
1109015950 13:57014473-57014495 AGACAGGAACACCAGGAGAGAGG - Intergenic
1109080366 13:57891856-57891878 TCCCAGGGAAGCCAGCAGTGTGG - Intergenic
1111354341 13:87079567-87079589 AGCCATGGACCACAGCAGAGTGG - Intergenic
1113333362 13:109353794-109353816 TGCCAGGTAAACCAGGAGAAAGG + Intergenic
1113961780 13:114130349-114130371 TCCCAGGGGCAGCAGCAGTGAGG - Intronic
1114007818 14:18333114-18333136 TGCCAGCGCCACCAGCAGCGTGG + Intergenic
1114064931 14:19052907-19052929 TGCCAGCGCCACCAGCAGCGCGG - Intergenic
1114097330 14:19347095-19347117 TGCCAGCGCCACCAGCAGCGCGG + Intergenic
1114406889 14:22465144-22465166 TCCCAGGGACACAGGCAGTGTGG + Intergenic
1115583057 14:34781417-34781439 TGCCAGGGGCAGCAGGAAAGAGG - Intronic
1118384647 14:65245534-65245556 GGCTTGGCACACCAGCAGAGAGG + Intergenic
1118616632 14:67578510-67578532 TGCCAGGGACACAGACAGCGTGG - Intronic
1119173871 14:72555033-72555055 TGCCAGGAACACCAGCAGGGAGG + Intronic
1119633396 14:76253783-76253805 TCCCAGGGACACCAGCTGGCTGG + Intronic
1120840538 14:89081346-89081368 CAGCAGGGACACCATCAGAGGGG + Intergenic
1121250970 14:92499010-92499032 TTCCAGGGAAGCCAGCTGAGAGG + Exonic
1121692667 14:95889145-95889167 GGCCAGGGACAGCAGGGGAGGGG - Intergenic
1122370893 14:101228475-101228497 CTCCAGGGACACCGGCAGACGGG - Intergenic
1122965809 14:105125068-105125090 TGCCAAGGTCAAAAGCAGAGTGG + Intergenic
1123062526 14:105600701-105600723 TGCCAGGTCCACCACCAGACAGG + Intergenic
1123087265 14:105722429-105722451 TGCCAGGTCCACCACCAGACAGG + Intergenic
1123491685 15:20786247-20786269 TGCCAGTGCCACCAGCAGTGCGG + Intergenic
1123548187 15:21355341-21355363 TGCCAGTGCCACCAGCAGTGCGG + Intergenic
1123956921 15:25346124-25346146 TGCCAGGAACACCAGCAAGGGGG + Intronic
1125576193 15:40757197-40757219 TGCCAGGGCAATCAGCAGTGTGG + Intergenic
1126782474 15:52150443-52150465 TGCCAGGGACAGCTGCGGAGGGG + Intronic
1126895789 15:53255926-53255948 TGCCTGAGACAGCTGCAGAGTGG + Intergenic
1127828989 15:62733181-62733203 GGGCAGGGAAACCAGGAGAGAGG + Intronic
1128302328 15:66574405-66574427 TGCCTGGGACCCCTGCAGGGCGG + Intergenic
1128510387 15:68310715-68310737 TGCCAGGCAAACGAGCAGAAAGG - Intronic
1129688522 15:77700077-77700099 TGGCTGGGGAACCAGCAGAGGGG + Intronic
1129739578 15:77983767-77983789 AGGCAGAGCCACCAGCAGAGGGG + Intergenic
1129846328 15:78769280-78769302 AGGCAGAGCCACCAGCAGAGGGG - Intronic
1130255964 15:82326218-82326240 TGACAGGCTCACCAGCAGGGAGG - Intergenic
1130559244 15:84945514-84945536 TGTGAGGGACCCCAGGAGAGGGG - Exonic
1130598991 15:85263768-85263790 TGGCAGGCTCACCAGCAGGGAGG + Intergenic
1131109333 15:89755063-89755085 TGGCATGGACAACGGCAGAGAGG - Intergenic
1202956519 15_KI270727v1_random:82571-82593 TGCCAGTGCCACCAGCAGTGCGG + Intergenic
1132519611 16:381351-381373 TGCCCGGGACTCCAGCTGGGAGG - Intronic
1132690629 16:1180479-1180501 CGCCAGGGACACCAGGACACAGG - Intronic
1134441219 16:14300911-14300933 TCCCAGGGACCCCAGCCAAGGGG - Intergenic
1135039376 16:19106177-19106199 TGCCAGCCACACTAGCAAAGCGG + Intergenic
1136246900 16:28981495-28981517 TACCAGGAACAGCAGCAGAACGG - Exonic
1136385762 16:29925223-29925245 TGCCAGGGACACCAGAGTGGAGG - Intronic
1136395042 16:29987913-29987935 TGCCAGGGACTCTAGCCGGGCGG + Exonic
1137690236 16:50421267-50421289 TACCTGGGAAACCAGCATAGAGG - Intergenic
1139937617 16:70582781-70582803 TGCCTGTGTCAACAGCAGAGAGG - Intronic
1140264485 16:73408600-73408622 TGAGAGGAACACGAGCAGAGCGG + Intergenic
1140729593 16:77843909-77843931 TGCCAGGGAGAGCAGGAGACAGG + Intronic
1142486157 17:248686-248708 TTCCAGGGACAGCAGGAGTGGGG - Intronic
1143531615 17:7508331-7508353 TGGCAGACACACCAGCATAGTGG - Exonic
1143768414 17:9152431-9152453 TCCCAGGGGAACCATCAGAGGGG - Intronic
1148461815 17:47843454-47843476 TGCCAGGCACCCCATCTGAGGGG + Intergenic
1148907161 17:50918951-50918973 TCCTAGGGACAGCAGCAGAGAGG + Intergenic
1149450701 17:56747961-56747983 TGACAGTGACAGCAGGAGAGTGG - Intergenic
1150238639 17:63613899-63613921 AGCCAGGGCCTCTAGCAGAGGGG - Intergenic
1151142170 17:72004088-72004110 TGCCAAGGGCACAGGCAGAGTGG - Intergenic
1151228475 17:72664469-72664491 TGCCAGGGAAACCAGAGGCGGGG + Intronic
1151351634 17:73535348-73535370 TGTCAGCGACACCAGGAGGGAGG - Intronic
1151893057 17:76962546-76962568 AGCCATGGCCACCAGCAGAGAGG + Intergenic
1152025007 17:77803130-77803152 TGCCAGGGAAACAAGCGAAGAGG + Intergenic
1152518422 17:80839580-80839602 TGACAGGGTCTCCTGCAGAGTGG + Intronic
1152906758 17:82974663-82974685 GGCCAGGGACACCCGCTGTGGGG - Intronic
1153881917 18:9428534-9428556 TGCCTAGGACACCACCAGATAGG - Intergenic
1154373230 18:13785556-13785578 TTCCAGGCACCCCACCAGAGAGG - Intergenic
1155618657 18:27750305-27750327 TGTCAGGGACATCACCAGATAGG + Intergenic
1155776045 18:29762955-29762977 TGTCAGAGACACAGGCAGAGGGG - Intergenic
1155781654 18:29844973-29844995 GGCCAGGGACACCAATAAAGGGG + Intergenic
1156369971 18:36464667-36464689 TGCCAGAGACACAGTCAGAGAGG + Intronic
1158640076 18:59196206-59196228 CTCCAAAGACACCAGCAGAGGGG + Intergenic
1159713832 18:71797328-71797350 TGCCAGGGCCATGAGCATAGAGG + Intergenic
1160512814 18:79461887-79461909 TGCTTGGGACACCATCACAGGGG - Intronic
1161783974 19:6311798-6311820 TGCCAGGAACGCCAGGTGAGAGG + Intronic
1162097035 19:8316495-8316517 TGTCAGGCAAGCCAGCAGAGAGG - Exonic
1162097701 19:8320936-8320958 TGCAAGGCACCCCAGGAGAGAGG + Intronic
1162199654 19:9011013-9011035 TGCCCTTGACAGCAGCAGAGAGG + Intergenic
1162337350 19:10070211-10070233 AGCCAGAGACAACAGCAGTGGGG + Intergenic
1162369480 19:10270305-10270327 AGCCTGGGACGCCAGCGGAGGGG + Intergenic
1163127787 19:15253625-15253647 TGGCAGGGCCAGCAGCAGACTGG + Intronic
1163183307 19:15618912-15618934 GGCCAGGGAGAGCAGCAGAAGGG + Intronic
1164814121 19:31181312-31181334 TGGCAGGGACCTCAGCAAAGGGG + Intergenic
1165482572 19:36073459-36073481 TGTCAAGGACATCAACAGAGTGG + Exonic
1166007558 19:39917763-39917785 TGCGGGGGACACAGGCAGAGGGG - Intronic
1166777552 19:45322172-45322194 TGCCAGGGACACCCCAGGAGAGG + Intronic
1166824756 19:45601941-45601963 AGCCAGGGAGAGCAACAGAGGGG + Intronic
1167111682 19:47466280-47466302 TGACAGCGACACCAGCACAGGGG - Exonic
925535368 2:4910895-4910917 TGCCAGGGACGCAGGCAGAGAGG + Intergenic
926572299 2:14543149-14543171 TGCTAGTGTCATCAGCAGAGAGG + Intergenic
927562359 2:24083043-24083065 TGCCAGGGACACTGGAAGATCGG - Exonic
928932201 2:36636352-36636374 TGACAGGGACAGCACCATAGAGG + Intronic
929828691 2:45330193-45330215 AGCGAGGGGCACCAGCAGTGTGG - Intergenic
932118762 2:69078534-69078556 TGCTAGGAGCTCCAGCAGAGTGG + Intronic
933751671 2:85606412-85606434 TGCCTTGGACCCCAGCTGAGGGG + Intronic
933851450 2:86369995-86370017 TGGAAGAGACATCAGCAGAGAGG + Intergenic
935680019 2:105627974-105627996 TTCCAATGACAGCAGCAGAGGGG + Intergenic
936806781 2:116342908-116342930 ATCAAGGAACACCAGCAGAGGGG - Intergenic
937835809 2:126469328-126469350 AGCCAGAGAAACCAGGAGAGAGG - Intergenic
937900091 2:127013379-127013401 TGGCAGAGACAGCAGCAGAGAGG + Intergenic
938208049 2:129440317-129440339 AGCCGGGGCCACCGGCAGAGTGG - Intergenic
938482194 2:131671910-131671932 TGCCAGCTCCACCAGCAGCGCGG - Intergenic
938528737 2:132162289-132162311 TGCCAGCGCCACCAGCCGCGCGG - Intronic
939404169 2:141734676-141734698 TGCCAAGGAGACAGGCAGAGAGG - Intronic
941049454 2:160715884-160715906 TGACGAGGACACCAGCATAGTGG - Intergenic
945222856 2:207502488-207502510 TGCCAGGAACAGCAAGAGAGGGG + Intergenic
946189772 2:218002158-218002180 TGCCAGGGGGGCCAGCAGAGAGG - Intronic
948701075 2:239760742-239760764 AGCCGGGGACACCAGCAGGGAGG + Intergenic
948704420 2:239780073-239780095 TGCCAAGTAGCCCAGCAGAGGGG + Intronic
1169552413 20:6714657-6714679 TGCCAGTGACAAAGGCAGAGAGG + Intergenic
1170533931 20:17321966-17321988 TGCCAGGTACTGTAGCAGAGAGG - Intronic
1170736073 20:19015196-19015218 TGCCAGGGATGCTAGCACAGTGG - Intergenic
1170827703 20:19810446-19810468 TGCCAGGGCCCCCAGGAGGGAGG + Intergenic
1171113935 20:22508415-22508437 AGCCAGGGAAACCAGGGGAGGGG - Intergenic
1171293398 20:23995393-23995415 TGCCAGGTCCACAAGCAGAGAGG + Intergenic
1171446484 20:25207832-25207854 GGCCAGGGGCAACAGCCGAGAGG + Intronic
1171797307 20:29576571-29576593 TGCCTGGGACACCAGCTTAGGGG - Intergenic
1171850945 20:30307590-30307612 TGCCTGGGACACCAGCTTAGTGG + Intergenic
1172314192 20:33940842-33940864 TGCCCAGGACACCTGCAGAGAGG - Intergenic
1172617356 20:36298080-36298102 AGCCAGGGACACCAGAAAGGAGG - Intergenic
1174136372 20:48382813-48382835 GGGCAGGGAGACCAGCAGGGAGG + Intergenic
1174489258 20:50880646-50880668 GGACAGGGACACCAGTAGAAAGG + Intronic
1175371480 20:58495856-58495878 TGCCAGGGCCATCAGCGGAGTGG + Intronic
1176022205 20:62967587-62967609 TGTCAGACACACGAGCAGAGAGG + Exonic
1176043570 20:63080988-63081010 TGCATGGGACACCAGGAGGGTGG - Intergenic
1176168642 20:63687373-63687395 GGCTGGGGACACCTGCAGAGAGG - Intronic
1176342938 21:5714932-5714954 TGCCAAGGACCCCACAAGAGAGG + Intergenic
1176446941 21:6829595-6829617 TGCCAGTGCCACCAGCAGTGCGG - Intergenic
1176475192 21:7147083-7147105 TGCCAAGGACCCCACAAGAGAGG + Intergenic
1176501889 21:7609524-7609546 TGCCAAGGACCCCACAAGAGAGG - Intergenic
1176537259 21:8113001-8113023 TGCCAAGGACCCCACAAGAGAGG + Intergenic
1176767765 21:13037623-13037645 TGCCAGCGCCACCAGCCGCGCGG + Intergenic
1176825112 21:13694621-13694643 TGCCAGTGCCACCAGCAGTGCGG - Intergenic
1178914320 21:36698446-36698468 GGCCAGGGAGCCCAGCCGAGTGG - Intergenic
1179600839 21:42476347-42476369 AGCCAGGGGAGCCAGCAGAGAGG + Intronic
1179897399 21:44370308-44370330 TGCCAGGGACCACAGCACAGTGG - Intronic
1179958835 21:44757041-44757063 CGCCGGAGACACCAGCAGACAGG + Intergenic
1180141390 21:45895661-45895683 TGCCAAGGACACCAGCCGTTTGG + Intronic
1180432324 22:15263924-15263946 TGCCAGCGCCACCAGCAGCGTGG + Intergenic
1180483420 22:15775527-15775549 TGCCAGCGCCACCAGCAGCGCGG - Intergenic
1180514888 22:16131861-16131883 TGCCAGCGCCACCAGCAGCGTGG + Intergenic
1180824455 22:18853109-18853131 TGCCAGGTCCACAAGCAGAGAGG + Intronic
1181188279 22:21121439-21121461 TGCCAGGTCCACAAGCAGAGAGG - Intergenic
1181210919 22:21289054-21289076 TGCCAGGTCCACAAGCAGAGAGG + Intergenic
1181398586 22:22637834-22637856 TGCCAGGTCCACAAGCAGAGAGG - Intergenic
1181501323 22:23317192-23317214 TGCCAGGTCCACAAGCAGAGAGG - Exonic
1181650831 22:24258226-24258248 TGCCAGGTCCACAAGCAGAGAGG + Intergenic
1181706551 22:24652513-24652535 TGCCAGGTCCACAAGCAGAGAGG - Intergenic
1181909549 22:26227816-26227838 TGCCAGGGAAGCCTGCAGAGTGG + Intronic
1182243565 22:28936498-28936520 TGCCAGGGCATCCAGCAGAGTGG - Intronic
1182360616 22:29744434-29744456 TGCCAGGGGGACCAGCAGGGTGG + Intronic
1182483676 22:30626572-30626594 TTCCAGGGACATCAGGAGGGAGG - Exonic
1182713531 22:32337207-32337229 TTCCAGGGACACCCACAGACAGG - Intergenic
1183011744 22:34952385-34952407 TGCCAGCAACACCAGAAGTGAGG + Intergenic
1183589207 22:38770114-38770136 TGCCAGGGAGCCCAGAGGAGTGG - Intronic
1183945755 22:41324893-41324915 TGCCAGGGACAGGAGCAGGCAGG - Intronic
1184105337 22:42364162-42364184 AGCCAGGAAAACCAGCAAAGGGG + Intergenic
1184177179 22:42795006-42795028 AGGCAGAGCCACCAGCAGAGGGG - Intergenic
1184400794 22:44272771-44272793 TTCCAGGGACACCCACAGACAGG - Intronic
1184930837 22:47680076-47680098 TTTCAGGGACTCCAGGAGAGAGG + Intergenic
1203216028 22_KI270731v1_random:6376-6398 TGCCAGGTCCACAAGCAGAGAGG - Intergenic
1203242202 22_KI270733v1_random:29405-29427 TGCCAAGGACCCCACAAGAGAGG + Intergenic
1203274594 22_KI270734v1_random:79014-79036 TGCCAGGTCCACAAGCAGAGAGG + Intergenic
951580051 3:24153056-24153078 AGCCAGTGACTCAAGCAGAGAGG + Intronic
951823771 3:26844197-26844219 TACCAGGGAAACCAGCTGAGTGG + Intergenic
953861428 3:46547032-46547054 TGCCACTGACACCAAGAGAGGGG - Intronic
956754771 3:72373718-72373740 TACCAGTGCCACCAGCAGTGGGG + Exonic
957845059 3:85721556-85721578 TGCCAGGTGCTCCAGCAGGGCGG + Intronic
957884217 3:86263238-86263260 TGCCAGTGACACCCGCAGACAGG - Intergenic
960844789 3:121995438-121995460 TGCCAAGGCCAGCAGCAAAGGGG + Intronic
961016121 3:123469747-123469769 TCTCGGGGACAGCAGCAGAGGGG - Intergenic
961034672 3:123634289-123634311 TTCCAGGCTCAGCAGCAGAGAGG + Intronic
962334197 3:134511269-134511291 TGCCAGGAACATCAGCAAAGGGG - Intronic
967082806 3:186065868-186065890 TGCCAGGGCCCCCAGCACACGGG - Exonic
967192479 3:186996859-186996881 TAGCAGGGACCCAAGCAGAGAGG - Intronic
968555036 4:1242567-1242589 TTCCAGAGACACCATCACAGGGG + Intronic
969240693 4:5895063-5895085 ACCCAGGGACACAAGGAGAGAGG - Intergenic
969395517 4:6918076-6918098 GGCCAGGGACAGCAGCCCAGTGG - Intronic
969486436 4:7474894-7474916 TGCCAGGGCCACCAGGAGGTGGG - Intronic
969588706 4:8109163-8109185 CGCCAGGCAGACCAGAAGAGGGG - Intronic
970035393 4:11729139-11729161 TGCCAGTAAGACCAGCATAGTGG - Intergenic
970039588 4:11780928-11780950 TGCCAGGAATATCAGCAGAAGGG - Intergenic
970425363 4:15940852-15940874 AGCCAATGACACCAACAGAGAGG - Intergenic
971132883 4:23833045-23833067 TGCCAGGGACATCTGAAGTGTGG + Intronic
973605353 4:52581629-52581651 TGCCAGGGACCCACTCAGAGAGG - Intergenic
973824468 4:54691475-54691497 TCCCAGGGACACAGGCAGAAGGG + Intronic
976840165 4:89423147-89423169 TGCCATGTAAACCAGCAGAAGGG + Intergenic
977368239 4:96101150-96101172 TGCCAGGGAACCCATCAGAGTGG - Intergenic
979586359 4:122423089-122423111 TGGCATTGAAACCAGCAGAGAGG - Intronic
980366360 4:131809344-131809366 AGCCTGGTACACCAGCAAAGGGG - Intergenic
980980878 4:139653733-139653755 AGCCAGGGACACCAGGAGTATGG - Intergenic
983936755 4:173507904-173507926 TTCCAGGCCCACCAGCGGAGGGG - Intergenic
984477524 4:180255986-180256008 TGACAGAGACACCAGCACACTGG - Intergenic
984697444 4:182793518-182793540 TGCCATGGAAATCAGCAGTGGGG + Exonic
984702368 4:182826458-182826480 GGCCCGGCACTCCAGCAGAGTGG + Intergenic
985148393 4:186919196-186919218 GGCCAGGGAACCAAGCAGAGGGG + Intergenic
985645056 5:1080867-1080889 TGCCTGGGAGAGCAGCAGACAGG + Intronic
986260623 5:6142894-6142916 TGCCAGCGACACCAGAAGGGAGG - Intergenic
986520714 5:8614794-8614816 AACCAGGGACACCAACAGCGTGG + Intergenic
988798973 5:34678699-34678721 GCCCTGGCACACCAGCAGAGGGG + Intronic
988896662 5:35682102-35682124 AGCCAAGCACACCTGCAGAGTGG + Intronic
991010797 5:61881306-61881328 AGCCAGAGACACCAGCCCAGGGG + Intergenic
993873545 5:93279703-93279725 TGGCAGGGAGAGGAGCAGAGAGG - Intergenic
994850917 5:105053783-105053805 TCCCAGTGAGACCAACAGAGAGG - Intergenic
996472387 5:123875858-123875880 TCCCAGGGACGCTCGCAGAGAGG + Intergenic
997223339 5:132188948-132188970 TGCCAGGCATATCAACAGAGTGG + Intergenic
998131066 5:139651255-139651277 GGCCAGGGTCACCTGCTGAGCGG - Intronic
998251145 5:140553726-140553748 TGGCAGGAACACCAGTTGAGAGG + Intronic
998280605 5:140803185-140803207 CACCAGCGACACCAGCACAGTGG - Exonic
998284979 5:140850483-140850505 CACCAGCGACACCAGCACAGTGG - Exonic
998353187 5:141514169-141514191 TTCCAGGCACAGCAGCAGACTGG + Intergenic
999426062 5:151488548-151488570 GGCGAGGTGCACCAGCAGAGGGG - Exonic
1001029003 5:168248004-168248026 TGCCATGGAGAGCAGCAGTGGGG + Exonic
1001085636 5:168698471-168698493 TGCCAGGAACACCAGAAGCCAGG + Intronic
1001588938 5:172852430-172852452 TGCCAGGGACCCAGGCAGGGAGG + Intronic
1002052232 5:176577573-176577595 TGCCAGGGGCAGAAGCCGAGGGG + Intronic
1002080621 5:176735132-176735154 TGTGAGGAAAACCAGCAGAGAGG + Intergenic
1002134799 5:177100896-177100918 TGCCAGGGACGCTGGCAGGGAGG - Intergenic
1002644950 5:180648570-180648592 TTCCAGGGACACCAGCTCCGTGG + Intronic
1002838759 6:887832-887854 GGCCAGCACCACCAGCAGAGGGG + Intergenic
1003361043 6:5425529-5425551 AGCCAGGGACACTTGCAGGGCGG - Intronic
1003421180 6:5959973-5959995 AGCCAGGGACACCAGAAGCCGGG - Intergenic
1003517789 6:6832305-6832327 TGCCAGATTCACCAGCATAGAGG + Intergenic
1004426945 6:15513175-15513197 TGCCATGCTCACCAGCAGAGGGG - Intronic
1005484482 6:26286513-26286535 TGCCTGGCAGAACAGCAGAGTGG + Intergenic
1006789017 6:36686598-36686620 GGGGAGGGACAGCAGCAGAGGGG - Exonic
1007053722 6:38860059-38860081 AGCCAGGGCCACCAGGAGCGGGG - Intronic
1007091241 6:39186079-39186101 AGGCAGGGAGACCAGCAGATGGG + Intergenic
1007601278 6:43083222-43083244 GCCCAGGCACAGCAGCAGAGAGG - Intronic
1011820323 6:91245450-91245472 TGGAAGGGACAACAGCAGTGAGG + Intergenic
1014769040 6:125440407-125440429 TGTAAGGTACACCAGCAAAGTGG - Intergenic
1016037255 6:139396087-139396109 AGGCAAGAACACCAGCAGAGCGG - Intergenic
1017787876 6:157771665-157771687 TGCCAGGGACATATCCAGAGTGG + Intronic
1018176454 6:161182570-161182592 TGCCAGGGACACATGCAGCATGG - Intronic
1018663684 6:166113818-166113840 GGCCAGACACTCCAGCAGAGGGG - Intergenic
1018870351 6:167778066-167778088 TGCTAGGGACAGCAACAGAGTGG - Intergenic
1019195694 6:170281441-170281463 GGCCAGCAACACCAGCAAAGAGG - Intergenic
1019500537 7:1362376-1362398 TGCCTGGGGCACTGGCAGAGGGG - Intergenic
1019777268 7:2919280-2919302 TGCCACGAACATCAGCAGAGGGG - Intronic
1019865981 7:3710717-3710739 TGATTGGGAAACCAGCAGAGAGG + Intronic
1021590524 7:22256071-22256093 TACAAAGAACACCAGCAGAGGGG - Intronic
1021781679 7:24113163-24113185 TGCTAGGGACACAAGGACAGTGG - Intergenic
1022045720 7:26620688-26620710 TGCTGGGCACACCTGCAGAGGGG + Intergenic
1024259100 7:47560556-47560578 TGCCCCTGACAGCAGCAGAGAGG - Intronic
1024458215 7:49632584-49632606 TGCTAAGGACACCTGCAGAGAGG + Intergenic
1025721983 7:64025453-64025475 TGCCTGGGACATGTGCAGAGGGG + Intergenic
1026599325 7:71762685-71762707 AGCCTGGGAGTCCAGCAGAGAGG - Intergenic
1031570754 7:123356373-123356395 TACCAGGGATAGCAGCAGACAGG - Intergenic
1031858976 7:126957337-126957359 TGGCAGGGACACCAGCTGAGTGG + Intronic
1032430731 7:131859244-131859266 GGCCATGGACACCTGGAGAGAGG + Intergenic
1032580124 7:133096470-133096492 TCCAAGAGAGACCAGCAGAGGGG + Intergenic
1034258111 7:149735469-149735491 AGCCTGGGACACCAGCACTGTGG + Intergenic
1034628808 7:152514782-152514804 TGCCAGGGACACCTGCTGCGTGG + Intergenic
1035056312 7:156039044-156039066 TGCCAGGGTCTCCAGGGGAGGGG - Intergenic
1035327648 7:158075368-158075390 TGCCGGAGAGACCAGCAGACAGG - Intronic
1035993298 8:4516405-4516427 TTCCATGGACACCAGCAGCTTGG - Intronic
1036282550 8:7414209-7414231 GGCATGGGACACAAGCAGAGGGG - Intergenic
1036338922 8:7897340-7897362 GGCATGGGACACAAGCAGAGGGG + Intergenic
1036680630 8:10870328-10870350 TGCAAGGCACATCAGAAGAGTGG - Intergenic
1037049186 8:14348359-14348381 AGCCAGGGACACAAGAAGTGAGG - Intronic
1038619119 8:29123365-29123387 TTCCAGGGGCCCCAGCAGAATGG - Exonic
1039612875 8:38932986-38933008 TGCCAGGGAGGCCAGGACAGAGG + Intronic
1039909172 8:41810627-41810649 CGTCAGGGACGCCAGAAGAGAGG - Intronic
1040543420 8:48379555-48379577 TACCGGGGCCACCAGCAAAGCGG - Intergenic
1041136065 8:54760728-54760750 TCCGAGGGACAAAAGCAGAGTGG - Intergenic
1041260513 8:56017333-56017355 GGGCTGGGACACCAGCAGTGTGG - Intergenic
1041381674 8:57259187-57259209 TGCCGGCGCCACCAGCAGCGCGG + Intergenic
1041384040 8:57279973-57279995 TGCCCGAGCCACCAGCAGCGCGG + Intergenic
1042664346 8:71189775-71189797 TGCTAGGGACAGCATCAAAGGGG + Intergenic
1043516771 8:81001876-81001898 TGTCTGGGACAGCAGCAGACAGG + Intronic
1044898004 8:96913235-96913257 TGCCAGCCCCACCAGCAGTGTGG - Intronic
1045094565 8:98784496-98784518 TGCCAGGGAGTAGAGCAGAGAGG - Intronic
1046609144 8:116404733-116404755 TGCCGGGGATGCCAGCAGAGTGG - Intergenic
1047192841 8:122694054-122694076 TGCCATGGAGACCACAAGAGTGG - Intergenic
1048577201 8:135702120-135702142 TGCAGGGGACCCCAGCAGTGAGG + Intergenic
1049362209 8:142217443-142217465 CACCATGGACAGCAGCAGAGGGG - Intronic
1049572366 8:143375256-143375278 TGCCAAGGACACCAGAAGCCAGG - Intronic
1049921522 9:369254-369276 TGCCAGGGGCCTGAGCAGAGAGG - Intronic
1050388681 9:5114250-5114272 TGCCAGGTCCACCACCAGACAGG - Intronic
1050547811 9:6723556-6723578 TGCAGAGGACACCAGCAGTGGGG - Intronic
1051261350 9:15268369-15268391 TGGCAGGGAGACGAGCTGAGAGG - Intronic
1053355073 9:37438603-37438625 AGCCAGTGACACAGGCAGAGCGG - Exonic
1053465918 9:38308507-38308529 TGCCAGGCACATCAGCCGGGTGG - Intergenic
1053707355 9:40768631-40768653 TGCCAGCGCCACCAGCAGCATGG - Intergenic
1054417269 9:64889399-64889421 TGCCAGCGCCACCAGCAGCATGG - Intergenic
1056753051 9:89365352-89365374 GGCCAGGCACCCCAGCAGCGTGG + Intronic
1060816524 9:126638176-126638198 TGCCAGGGACACCAGCAGAGAGG - Intronic
1061091874 9:128431113-128431135 TGCCAGAGACCCCTCCAGAGGGG - Intronic
1061277685 9:129578868-129578890 TCCCAGGGTCACCAGCCCAGTGG - Intergenic
1061282155 9:129603623-129603645 TGCAAGGGACACAACCTGAGGGG - Intergenic
1061449124 9:130659333-130659355 CGCCGGGGACACCAGGAGACCGG - Intergenic
1061837931 9:133341583-133341605 CTCCGGGGACGCCAGCAGAGGGG + Exonic
1061991077 9:134159103-134159125 TGCCAGGAGCACAGGCAGAGGGG - Exonic
1062044323 9:134418076-134418098 TGCCAGGGAGGGCAGCACAGGGG + Intronic
1062146905 9:134994564-134994586 TACCAGGGCCACCTGCATAGGGG + Intergenic
1062153302 9:135032503-135032525 TGTGAGGGACACCAGAAGTGGGG - Intergenic
1062262562 9:135670242-135670264 CTCCAGGGACCCCAGCAGTGGGG + Intergenic
1203522249 Un_GL000213v1:54936-54958 TGCCAGTGCCACCAGCAGTGCGG + Intergenic
1203458530 Un_GL000220v1:12482-12504 TGCCAAGGACCCCACAAGAGAGG + Intergenic
1186180310 X:6967299-6967321 TGCTGGGGACACCAGCTAAGGGG - Intergenic
1186464661 X:9775535-9775557 TGCATGAGGCACCAGCAGAGGGG + Intronic
1187246466 X:17557182-17557204 TGCCAAGGTAACCATCAGAGGGG - Intronic
1191256783 X:58282947-58282969 TGCCTGGGACAAAAGCAGTGAGG - Intergenic
1191256893 X:58283389-58283411 GGCCTGGGACAAAAGCAGAGAGG - Intergenic
1193414534 X:81205719-81205741 TGCCATGGAAAACAGCATAGAGG - Intronic
1194459866 X:94152977-94152999 TGCCAGGGACATAATAAGAGGGG - Intergenic
1197402397 X:126007179-126007201 TTGCAGAGACAGCAGCAGAGAGG - Intergenic
1198428551 X:136543355-136543377 TGCAAGTGCCACCAGCAAAGAGG + Intronic
1198764128 X:140063600-140063622 TGCTAGGGGCACCAGCAATGTGG - Intergenic
1199634684 X:149804158-149804180 TTCCAGGGTCACCATCAGAACGG + Intergenic
1200116276 X:153771067-153771089 TGCCAGGCCCACCAGGTGAGTGG + Exonic
1200985979 Y:9303880-9303902 TCTCAGGGAGACCAGAAGAGGGG + Intergenic
1202068218 Y:20962526-20962548 TGCCAGAAACCCCAGCAGTGAGG + Intergenic