ID: 1060816528

View in Genome Browser
Species Human (GRCh38)
Location 9:126638191-126638213
Sequence CTGTCGGGACCCACCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060816528_1060816536 -7 Left 1060816528 9:126638191-126638213 CCCTGGCAGGTGGGTCCCGACAG No data
Right 1060816536 9:126638207-126638229 CCGACAGGAATGCTCCGGTGGGG No data
1060816528_1060816537 -6 Left 1060816528 9:126638191-126638213 CCCTGGCAGGTGGGTCCCGACAG No data
Right 1060816537 9:126638208-126638230 CGACAGGAATGCTCCGGTGGGGG No data
1060816528_1060816534 -8 Left 1060816528 9:126638191-126638213 CCCTGGCAGGTGGGTCCCGACAG No data
Right 1060816534 9:126638206-126638228 CCCGACAGGAATGCTCCGGTGGG No data
1060816528_1060816540 19 Left 1060816528 9:126638191-126638213 CCCTGGCAGGTGGGTCCCGACAG No data
Right 1060816540 9:126638233-126638255 CCCTGCTGCTGTGCCCTCCCAGG No data
1060816528_1060816532 -9 Left 1060816528 9:126638191-126638213 CCCTGGCAGGTGGGTCCCGACAG No data
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060816528 Original CRISPR CTGTCGGGACCCACCTGCCA GGG (reversed) Intronic