ID: 1060816528

View in Genome Browser
Species Human (GRCh38)
Location 9:126638191-126638213
Sequence CTGTCGGGACCCACCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060816528_1060816532 -9 Left 1060816528 9:126638191-126638213 CCCTGGCAGGTGGGTCCCGACAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816528_1060816540 19 Left 1060816528 9:126638191-126638213 CCCTGGCAGGTGGGTCCCGACAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1060816540 9:126638233-126638255 CCCTGCTGCTGTGCCCTCCCAGG No data
1060816528_1060816536 -7 Left 1060816528 9:126638191-126638213 CCCTGGCAGGTGGGTCCCGACAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1060816536 9:126638207-126638229 CCGACAGGAATGCTCCGGTGGGG No data
1060816528_1060816537 -6 Left 1060816528 9:126638191-126638213 CCCTGGCAGGTGGGTCCCGACAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1060816537 9:126638208-126638230 CGACAGGAATGCTCCGGTGGGGG No data
1060816528_1060816534 -8 Left 1060816528 9:126638191-126638213 CCCTGGCAGGTGGGTCCCGACAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1060816534 9:126638206-126638228 CCCGACAGGAATGCTCCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060816528 Original CRISPR CTGTCGGGACCCACCTGCCA GGG (reversed) Intronic
900130457 1:1085098-1085120 CAGTCGGGAGCCCGCTGCCAGGG - Intronic
901490337 1:9593397-9593419 CAGGCGGGCCCTACCTGCCAGGG - Intronic
902183816 1:14710425-14710447 CTTTAGGGCCCCACGTGCCACGG - Intronic
902247312 1:15129354-15129376 GTGCCAGGACCCCCCTGCCAGGG + Intergenic
905448467 1:38042695-38042717 GTGTGGGGCCCCTCCTGCCAGGG - Intergenic
909614223 1:77588921-77588943 CTGACGTTGCCCACCTGCCAGGG - Intronic
910856446 1:91700705-91700727 CTGATGGGACCCAGCTCCCAGGG - Intronic
912953080 1:114133997-114134019 CTGCCTGGTGCCACCTGCCAGGG + Intronic
917471272 1:175327872-175327894 CTGTGGTGATCCACCTGCCTCGG - Intronic
917909648 1:179630228-179630250 ATGTCGTGATCCACCTGCCTCGG + Intronic
921066076 1:211622798-211622820 CTCAGGGGACCCACCTGCCTTGG + Intergenic
1063022487 10:2143755-2143777 CTCTGGTGACCCACCTGCCTCGG - Intergenic
1064096364 10:12427326-12427348 CTCTGGGCAGCCACCTGCCATGG - Intronic
1066578383 10:36851857-36851879 CTGAAGTGATCCACCTGCCATGG + Intergenic
1067189469 10:44057415-44057437 GTGACTGGACCCACCTTCCAAGG + Intergenic
1070657737 10:78282785-78282807 GTGGCGGACCCCACCTGCCACGG - Intergenic
1070848237 10:79541365-79541387 CTGCCTGGCCCCACCTGCCCCGG + Intergenic
1070925541 10:80218804-80218826 CTGCCTGGCCCCACCTGCCCCGG - Intergenic
1075031544 10:119027921-119027943 CTGCCAGGGCCCACCTGCCAGGG + Intergenic
1075287611 10:121200917-121200939 CTTTCGTGACCCACAGGCCAAGG + Intergenic
1075310219 10:121407478-121407500 CTGGCAGGAACCACCTGGCAAGG + Intergenic
1076226718 10:128782472-128782494 CTCAAGGGATCCACCTGCCACGG + Intergenic
1078457879 11:11489516-11489538 CTCTAGGGAGCGACCTGCCAAGG - Intronic
1080558846 11:33443231-33443253 CTGAAGGGACCCTCCTGCCTTGG + Intergenic
1084458868 11:69285226-69285248 CTCTCTGGACACACCTGCCCTGG + Intergenic
1084498446 11:69519675-69519697 CTGAAGGGACCCACCAGCCGAGG - Intergenic
1085637836 11:78172036-78172058 CTTTCTGGGCCCACCTCCCATGG + Exonic
1088365886 11:109039411-109039433 CTGTAAGAAGCCACCTGCCATGG + Intergenic
1094313848 12:29115769-29115791 CTGTAGGTACCCACCGGCCTCGG + Intergenic
1096203154 12:49700479-49700501 CTCACGCGACCCACCTGCCTCGG - Intronic
1096529956 12:52236249-52236271 CTGTCTGGTTCCACCTGCTATGG - Intronic
1098912739 12:76226216-76226238 CTCAAGGGACCCACCTGCCTTGG - Intergenic
1101114444 12:101518381-101518403 CTCAAGGGATCCACCTGCCATGG + Intergenic
1101982521 12:109420014-109420036 CTGTTGGGTACCACCAGCCATGG + Intronic
1102056636 12:109901131-109901153 CTGTTGGGACCAACCTGCCCTGG - Intronic
1103964291 12:124628597-124628619 CTGAAGGGATCCACCTGCCTCGG + Intergenic
1104019797 12:124984297-124984319 CTGAAGTGACCCACCTGCCTCGG - Intronic
1108736091 13:53284535-53284557 CTGACGTGATCCACCTGCCTTGG + Intergenic
1113604966 13:111598503-111598525 GTGTCCGGGCCCTCCTGCCAAGG - Intronic
1114559039 14:23577959-23577981 CTGTCAGGACCCCTCTGCCCCGG + Exonic
1116991238 14:51279040-51279062 ATGTCGTGATCCACCTGCCTCGG + Intergenic
1119529588 14:75350408-75350430 CTGTAGAGACACACCAGCCAAGG + Intergenic
1122964419 14:105115326-105115348 CTGTCGAGAGCCTCCTGCCCAGG + Intergenic
1122978959 14:105182496-105182518 CTGGAGGGAGCCAGCTGCCACGG - Intergenic
1126580309 15:50236798-50236820 ATCTCGTGACCCACCTGCCTCGG - Intergenic
1128545349 15:68562739-68562761 CCCTCGTGACCCACCTGCCTTGG - Intergenic
1130708228 15:86253480-86253502 ATGTCGTGATCCACCTGCCTCGG + Intronic
1133421579 16:5651284-5651306 CTCACGTGACCCACCTGCCTTGG + Intergenic
1133754870 16:8754950-8754972 CTGAAGTGACCCACCTGCCTCGG + Intronic
1134652631 16:15922389-15922411 CTCAAGGGACCCACCTGCCTTGG + Intergenic
1135073362 16:19371673-19371695 CTGTAGGGATCCTCCTGCCTTGG - Intergenic
1135701907 16:24640164-24640186 CTCTAGGGATCCACCTGCCTTGG - Intergenic
1135966519 16:27040153-27040175 CTGAAGGGATCCACCTGCCTCGG - Intergenic
1136993958 16:35174644-35174666 CTCTCAGGACCACCCTGCCAAGG + Intergenic
1141693364 16:85608568-85608590 TTCTCGGTAACCACCTGCCATGG - Intergenic
1142166909 16:88596080-88596102 CTCTCGGGAGCCACCTGCCCGGG - Intronic
1147013120 17:37467846-37467868 CTGAAGTGACCCACCTGCCTTGG - Intronic
1150151993 17:62817504-62817526 CTCTAGGGATCCACCTGCCTCGG + Intergenic
1151433958 17:74082722-74082744 CAGTCAGGAGCCAGCTGCCACGG + Intergenic
1151536477 17:74741740-74741762 CTGTAGAGCCCCACCTGCCAGGG - Intronic
1152579521 17:81159905-81159927 CTGGCTCTACCCACCTGCCAGGG - Intronic
1153873778 18:9346541-9346563 CTCAAGGGACCCTCCTGCCATGG - Intronic
1155626743 18:27843697-27843719 ATCTCTGGATCCACCTGCCATGG - Intergenic
1160772799 19:840657-840679 CCCACGGGACACACCTGCCACGG + Intergenic
1160859527 19:1231741-1231763 CTGTCCGCACCCACCTGACCCGG - Intronic
1161206623 19:3044651-3044673 CTGACGTGACCCTCCTGCCTCGG + Intronic
1162004275 19:7767330-7767352 ATGTCAGGACACACATGCCATGG + Intronic
1162915667 19:13873241-13873263 CAGTCTGGAGCCACCAGCCAAGG - Intronic
1164389317 19:27804835-27804857 CTCTCAGGACCACCCTGCCAAGG - Intergenic
1165455414 19:35907832-35907854 CTGTCAGGATCCACCTTCCCTGG - Intronic
1165477552 19:36039943-36039965 CTCCCGGGGACCACCTGCCAAGG - Exonic
1165722754 19:38091150-38091172 CTCAAGGGACCCACCTGCCTTGG - Intronic
1166718031 19:44981372-44981394 CTCAGGGGACCCACCTGCCTTGG + Intronic
1167803537 19:51762623-51762645 CTCTGGTGACCCACCTGCCTCGG + Intronic
1168403292 19:56098300-56098322 TCGTGGGGACCCACCTGCCCTGG + Intronic
927981477 2:27377586-27377608 CTCTCGGGGCCCACCAGCCCTGG - Exonic
928098648 2:28421801-28421823 CTGTAGTGATCCACCTGCCTCGG + Intergenic
932207858 2:69899661-69899683 CTGAAGGGATCCACCTGCCTTGG + Intronic
934728867 2:96643581-96643603 CTCAGGGGACCCACCTGCCTCGG + Intergenic
936697422 2:114966806-114966828 CTCAAGTGACCCACCTGCCATGG - Intronic
937325042 2:120985318-120985340 CTGTCCGGGCCCACCTGCCTGGG - Intronic
940270766 2:151887639-151887661 CTGTCTGGATCCAACAGCCATGG - Intronic
941119195 2:161508439-161508461 CTCAAGGGACCCACCTGCCTCGG + Intronic
944426234 2:199586258-199586280 CTGTGTGGAACCACTTGCCAGGG - Intergenic
944580680 2:201130098-201130120 CTGTGGAGACCCACCTGCTCAGG + Exonic
946416371 2:219542014-219542036 CCGCCGGGCCCCACCTGGCATGG - Exonic
947767082 2:232644723-232644745 CTGTCGTGATCCACCTGTCTTGG + Intronic
948205817 2:236162417-236162439 CAGCCGGGACCCACCTGCACTGG - Intergenic
1172138799 20:32707038-32707060 ATGTCGTGATCCACCTGCCTCGG - Intronic
1172303492 20:33865650-33865672 ATGTCAGTACCCACCTGCCCGGG + Intergenic
1173210472 20:41028395-41028417 CTCTGGGGTCCCAGCTGCCAAGG + Intergenic
1174688220 20:52476165-52476187 CTGTCGGGGCCCACCTCTCATGG + Intergenic
1175791486 20:61743045-61743067 CTGCCAGAATCCACCTGCCATGG + Intronic
1178707256 21:34886560-34886582 CGGTCGGGACCTCCCTGGCAGGG - Intronic
1179828670 21:43982611-43982633 CCGGCCGGACCCACCTCCCACGG - Exonic
1179999532 21:44989082-44989104 CTTTGGGGGACCACCTGCCAAGG - Intergenic
1180214693 21:46316741-46316763 CTGTGGGGGCTCAGCTGCCAAGG - Intronic
1180227997 21:46408955-46408977 CTCTGGTGACCCACCTGCCTCGG + Intronic
1180876013 22:19175605-19175627 CTCTCAGGACCACCCTGCCAAGG - Exonic
1180928871 22:19575466-19575488 CTGTAGTGACCCACCCGCCTTGG + Intergenic
1182428037 22:30285210-30285232 CTGTCAGGACTCACCTGGCCAGG + Exonic
1183656092 22:39185545-39185567 TTCTGGGGACCCGCCTGCCATGG + Intergenic
1184149570 22:42630418-42630440 CACTCGGGACCCAACTCCCAGGG + Intronic
1185128334 22:49023978-49024000 CTGCCGGGACCCACGTGTCTAGG - Intergenic
1185236542 22:49716755-49716777 CTGCTGGGCCCCACCTGCCTGGG - Intergenic
949766734 3:7535233-7535255 CTTACAGGACCCACCTGACAGGG + Intronic
954608677 3:51932895-51932917 CTGCCAGGACCTACCTGCCAGGG - Intergenic
955698433 3:61659439-61659461 CTGTCTGGACAAACCTGCAAAGG - Intronic
958801214 3:98758070-98758092 CTCTAGTGACCCACCTGCCTTGG + Intronic
959034327 3:101342897-101342919 CTCTCGTGATCCACCTGCCTCGG + Intronic
961142162 3:124564745-124564767 CTGTTGGGACCCACCGGCTCTGG - Intronic
961188936 3:124941028-124941050 CTCTAGTGACCCACCTGCCTCGG + Intronic
961435982 3:126916910-126916932 GAGCCAGGACCCACCTGCCAAGG + Intronic
961588870 3:127959923-127959945 TTGTCGGCACCCACGTGCCTTGG - Intronic
962281683 3:134057102-134057124 CTGTAGGGTCCCTCCTGCAAAGG - Intergenic
966143409 3:176783047-176783069 CTGTCAGGGTCCAGCTGCCAAGG + Intergenic
968744640 4:2353315-2353337 GTGTCAGGCCCCACCTCCCATGG + Intronic
968829336 4:2924424-2924446 CTGGCGGGAGCCTCCTGGCAGGG - Intronic
969326120 4:6444949-6444971 CTGAAGGGATCCACCTGCCTTGG - Intronic
971754127 4:30685515-30685537 CTGTCTGCACCCAGCTGCAAAGG - Intergenic
976010596 4:80483199-80483221 CTGAAGGGAGCCACATGCCACGG + Intronic
981610975 4:146593448-146593470 CTCTAGGGATCCACCTGCCTCGG - Intergenic
982220907 4:153124370-153124392 CTCTCTGGACCTACCTACCAAGG - Intergenic
984965480 4:185136215-185136237 CTCAAGGGATCCACCTGCCACGG + Intergenic
985529196 5:423992-424014 ATGTCGGGAGCCCCCTGCCAGGG - Intronic
985532769 5:443521-443543 CTGTGGGGACACATGTGCCAAGG - Intronic
985785342 5:1890296-1890318 CTGTCAGGACCAGCCTTCCAAGG - Intergenic
987310317 5:16675502-16675524 CTGAAGTGACCCACCTGCCTCGG - Intronic
987577754 5:19752633-19752655 TTCTAGGGCCCCACCTGCCATGG + Intronic
993168374 5:84384639-84384661 CTGCCGGGACCCACCCGCAGCGG - Exonic
1001683930 5:173578419-173578441 CTGTCCAGACCCACCTGCTGAGG + Intergenic
1002293511 5:178215235-178215257 CAGTCACCACCCACCTGCCAAGG - Intronic
1008623348 6:53293549-53293571 CTCAGGGGACCCACCTGCCTTGG + Intronic
1011726668 6:90216520-90216542 CTGAGGGGATCCACCTGCTAAGG + Intronic
1012991010 6:105925903-105925925 CTGTGGGAAGCCAGCTGCCATGG - Intergenic
1017827908 6:158095974-158095996 CTCTGGGCACCCACCTGCCGCGG + Exonic
1019109472 6:169698336-169698358 CTGTCTGTACCACCCTGCCATGG - Intronic
1019422571 7:957918-957940 CTCTCGGGAGCCCCCTGCCCAGG - Intronic
1019597792 7:1866305-1866327 CTGTCGGGACCCACAGCGCAAGG - Intronic
1021926338 7:25537953-25537975 CAGTTGGAAGCCACCTGCCATGG + Intergenic
1023169823 7:37379683-37379705 GTGTCAGGACCCAGCTGGCATGG + Intronic
1025958824 7:66203336-66203358 CTCACGGGACCCTCCTGCCTGGG + Intergenic
1026018984 7:66693706-66693728 CTCTCGGGACCCTCCTGAAATGG - Intronic
1034837902 7:154369597-154369619 CTCTGGGGATCCACCTGCCTTGG + Intronic
1037382406 8:18300374-18300396 ATCTCGGGATCCACCTGCCTTGG + Intergenic
1037801941 8:22040686-22040708 CTGTCGGGACTCACTGGCCATGG - Intergenic
1038637115 8:29296384-29296406 CTGTGAGGACACGCCTGCCAGGG + Intergenic
1039738718 8:40359946-40359968 CTCAAGGGACCCACCTGCCTTGG - Intergenic
1040549870 8:48429623-48429645 ATGTCGGGATCCACCTTACAGGG - Intergenic
1041003342 8:53473327-53473349 CTCACGTGACCCACCTGCCTCGG - Intergenic
1044166073 8:88985488-88985510 GTGTCGTGACCCACCTGCCTCGG + Intergenic
1048248616 8:132837795-132837817 CTGCCGGGACCCACCAGGTAAGG + Exonic
1048500391 8:134970023-134970045 CTGTCAGGTCCTTCCTGCCAAGG + Intergenic
1048613954 8:136054219-136054241 CTGTCTGCTCCCACCTGACAAGG + Intergenic
1049122924 8:140756089-140756111 CTCCAGGGACCCACCTGCCCCGG - Intronic
1049586517 8:143434945-143434967 CTGAGGGGACCCTCCTGGCACGG + Intergenic
1051335758 9:16064510-16064532 CTCTGGGGTCCCATCTGCCAGGG + Intergenic
1053022769 9:34707383-34707405 TTGTGGGATCCCACCTGCCAAGG - Intergenic
1055732224 9:79289954-79289976 CTGTCCGCACCCTCCTTCCAGGG + Intergenic
1056581141 9:87888687-87888709 CAGTTGGGCCCCACCTCCCAGGG + Exonic
1056783347 9:89568408-89568430 CTGATGGGACCCTTCTGCCAAGG + Intergenic
1059410701 9:114130481-114130503 CTGTCGGGCACCCCCTTCCATGG + Intergenic
1060527532 9:124328892-124328914 GTGTAGGGACCCACCCCCCAGGG + Intronic
1060816528 9:126638191-126638213 CTGTCGGGACCCACCTGCCAGGG - Intronic
1060825030 9:126683043-126683065 CTGTCGGGAGCCCCCAGCCGGGG - Intronic
1061162670 9:128904283-128904305 CTGAGGTGATCCACCTGCCACGG - Intronic
1186486642 X:9938790-9938812 CTGTCGGCGCCCTCCTGCCTGGG - Intronic
1192904309 X:75534014-75534036 CTCTGGTGACCCACCTGCCTTGG + Intergenic
1195793750 X:108620907-108620929 CTGTTGGAAGCCAGCTGCCATGG - Intronic
1200155558 X:153972878-153972900 AGGCCGGGACCCACCTCCCAGGG - Intronic