ID: 1060816529

View in Genome Browser
Species Human (GRCh38)
Location 9:126638192-126638214
Sequence CCTGTCGGGACCCACCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060816529_1060816536 -8 Left 1060816529 9:126638192-126638214 CCTGGCAGGTGGGTCCCGACAGG 0: 1
1: 0
2: 1
3: 20
4: 186
Right 1060816536 9:126638207-126638229 CCGACAGGAATGCTCCGGTGGGG No data
1060816529_1060816540 18 Left 1060816529 9:126638192-126638214 CCTGGCAGGTGGGTCCCGACAGG 0: 1
1: 0
2: 1
3: 20
4: 186
Right 1060816540 9:126638233-126638255 CCCTGCTGCTGTGCCCTCCCAGG No data
1060816529_1060816537 -7 Left 1060816529 9:126638192-126638214 CCTGGCAGGTGGGTCCCGACAGG 0: 1
1: 0
2: 1
3: 20
4: 186
Right 1060816537 9:126638208-126638230 CGACAGGAATGCTCCGGTGGGGG No data
1060816529_1060816532 -10 Left 1060816529 9:126638192-126638214 CCTGGCAGGTGGGTCCCGACAGG 0: 1
1: 0
2: 1
3: 20
4: 186
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816529_1060816534 -9 Left 1060816529 9:126638192-126638214 CCTGGCAGGTGGGTCCCGACAGG 0: 1
1: 0
2: 1
3: 20
4: 186
Right 1060816534 9:126638206-126638228 CCCGACAGGAATGCTCCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060816529 Original CRISPR CCTGTCGGGACCCACCTGCC AGG (reversed) Intronic
900012735 1:131081-131103 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
900042798 1:487068-487090 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
900064236 1:722059-722081 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
900088808 1:910367-910389 TCTGTCGGTCCCGACCTGCCTGG + Intergenic
900130458 1:1085099-1085121 CCAGTCGGGAGCCCGCTGCCAGG - Intronic
900886844 1:5421235-5421257 CCTCTAAGGACCCACCTGCTAGG - Intergenic
900899226 1:5505492-5505514 CCTCTCGGGGGCCACCAGCCAGG - Intergenic
901063217 1:6483264-6483286 CCTGTCCCCAGCCACCTGCCTGG - Intronic
901490338 1:9593398-9593420 CCAGGCGGGCCCTACCTGCCAGG - Intronic
902290492 1:15431782-15431804 CCTGTCAGGAGCCCCCAGCCTGG + Intergenic
903307139 1:22420855-22420877 CCTGTTTGGACTCACCTGGCTGG - Intergenic
903389722 1:22955256-22955278 CCTGGGGAGACACACCTGCCTGG - Intronic
903518438 1:23928611-23928633 CCTCACGTGATCCACCTGCCTGG - Intergenic
905202408 1:36323420-36323442 CCCGCGGGGACCCACCGGCCCGG + Intronic
905448468 1:38042696-38042718 CGTGTGGGGCCCCTCCTGCCAGG - Intergenic
906149156 1:43577640-43577662 GCTGCCGGGCCCCCCCTGCCTGG - Intronic
911308315 1:96259646-96259668 CCTGTGGTGAGCCACCTGCCAGG + Intergenic
912448880 1:109757783-109757805 CTTGTGGGGAGCCACCTACCAGG + Exonic
912953079 1:114133996-114134018 CCTGCCTGGTGCCACCTGCCAGG + Intronic
919811972 1:201414490-201414512 CCTGCCCCGCCCCACCTGCCAGG + Intronic
922261172 1:223947571-223947593 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
922735901 1:227978169-227978191 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
922740902 1:228013750-228013772 CCCGAGGGCACCCACCTGCCTGG - Intronic
924342341 1:243049750-243049772 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
1062844137 10:691003-691025 CCAGCCGGGACCCACCTGCACGG + Intergenic
1063598202 10:7456585-7456607 CCTGACGACACACACCTGCCTGG + Intergenic
1066734139 10:38455804-38455826 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
1070968308 10:80543352-80543374 CCTGGCCGGCCCCACCGGCCCGG + Intronic
1072497222 10:95973624-95973646 CCTGAGGTGATCCACCTGCCTGG - Intronic
1072945372 10:99805123-99805145 CCTGACTGTACCCACCTCCCAGG - Intronic
1073458346 10:103651190-103651212 GCTGTGGGGACCCAGCTGCCGGG - Intronic
1074535535 10:114325973-114325995 CCAGATGGGACCCACCTGACGGG - Intronic
1075003188 10:118812756-118812778 CCGGTCGGGACCAACCTCTCTGG + Intergenic
1075031543 10:119027920-119027942 CCTGCCAGGGCCCACCTGCCAGG + Intergenic
1075405578 10:122193545-122193567 ACTGTCCGTACTCACCTGCCAGG + Intronic
1075607261 10:123821092-123821114 CCTGTTGGGACCCAGGTGGCAGG - Intronic
1075677944 10:124309123-124309145 CCAGTGAGGCCCCACCTGCCAGG - Intergenic
1076293715 10:129367789-129367811 CCTGCCGGGACCACCCTGCAGGG + Intergenic
1076367532 10:129931835-129931857 CCTGTAGGGTCCCTCCTGCCTGG - Intronic
1076797860 10:132807541-132807563 CCTGTCCTGACCCAGCTGTCTGG + Intergenic
1078413028 11:11143232-11143254 CCTGTCTGTTCCAACCTGCCTGG + Intergenic
1079243949 11:18739833-18739855 CCTCTCAGGGCCCTCCTGCCAGG + Intronic
1081715308 11:45245966-45245988 CCTGGCTGGACCCACCTTTCAGG - Intronic
1083428665 11:62602446-62602468 CCTGGCGGGACCGACTGGCCCGG - Exonic
1089759313 11:120711438-120711460 CCTGGCGGGACCCATCCCCCTGG + Intronic
1090229588 11:125092078-125092100 CCTGTCTGCACCCATCTCCCAGG + Intergenic
1097182456 12:57179114-57179136 CCTATCGGGACCCTCCCGACTGG - Intronic
1100480032 12:94969085-94969107 CCTGTCTGGTCCCACCTGCTAGG + Intronic
1102509415 12:113403976-113403998 CCTGCCAGGACCCACCCCCCTGG + Intronic
1102566308 12:113799627-113799649 CCCGCCGGGAGCCCCCTGCCAGG + Intergenic
1103561964 12:121797522-121797544 GGTGTCGGGACCCACCTGGCTGG - Intronic
1104855960 12:131902668-131902690 CAAGTTGGGACCCACCTCCCGGG + Intronic
1107964780 13:45588775-45588797 CCTGCCAGGTCTCACCTGCCGGG + Intronic
1110544872 13:76744914-76744936 CCTCAGGTGACCCACCTGCCTGG - Intergenic
1113596681 13:111538782-111538804 CCTGTGGCCACCCACCGGCCTGG + Intergenic
1115239809 14:31243098-31243120 CCTGAGGTGATCCACCTGCCTGG + Intergenic
1119644883 14:76341044-76341066 CCTGTCTCGACCCACCTTCTGGG - Intronic
1122006971 14:98713574-98713596 CCTGAAGTGATCCACCTGCCTGG - Intronic
1123688542 15:22817976-22817998 CCCTTCGTGATCCACCTGCCTGG - Intronic
1128269238 15:66293894-66293916 CCGGTGGGGACCCAGCGGCCCGG + Intronic
1128341552 15:66825905-66825927 CCTGCCGGGGCCCACCTTGCAGG + Intergenic
1128496081 15:68199481-68199503 ACTGTCTGCACCCACCTGCTGGG + Intronic
1128841351 15:70853849-70853871 CCCCTCGGGGCCCACCTCCCGGG + Intronic
1130093224 15:80838272-80838294 CCTGTCAGGACCCTCCTTCCTGG + Intronic
1130093595 15:80840377-80840399 CCTGTCAGGACCCTCCTTCCTGG + Intronic
1132055326 15:98647720-98647742 CCTGTCTGGGCCCCCCTTCCGGG + Intergenic
1132674488 16:1116112-1116134 GGTGTAGGGACCCCCCTGCCTGG - Intergenic
1132870589 16:2114116-2114138 CCTGTCTGCAGGCACCTGCCTGG + Intronic
1132889244 16:2196090-2196112 CCTGGCGGCACCCGCCTCCCGGG - Intronic
1132907367 16:2289642-2289664 CCGGTCAGGACCCAGCTCCCCGG + Intronic
1133180701 16:4052077-4052099 CCTGCAGGGACTCTCCTGCCAGG + Intronic
1134079614 16:11315910-11315932 CCAGCCGGGACCCACATGCTGGG - Intronic
1134521943 16:14922788-14922810 CCTGTCTGCAGGCACCTGCCTGG - Intronic
1134709612 16:16321439-16321461 CCTGTCTGCAGGCACCTGCCTGG - Intergenic
1134716826 16:16361468-16361490 CCTGTCTGCAGGCACCTGCCTGG - Intergenic
1134949990 16:18347206-18347228 CCTGTCTGCAGGCACCTGCCTGG + Intergenic
1134957926 16:18390691-18390713 CCTGTCTGCAGGCACCTGCCTGG + Intergenic
1136295760 16:29301303-29301325 CCTGCCGCCACCCACCTTCCGGG + Intergenic
1142101678 16:88275490-88275512 CCTGCCGCCACCCACCTTCCGGG + Intergenic
1142166910 16:88596081-88596103 GCTCTCGGGAGCCACCTGCCCGG - Intronic
1142451604 16:90175837-90175859 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
1142743322 17:1942800-1942822 CCTGTGAGGCCACACCTGCCAGG + Intronic
1142876262 17:2853554-2853576 GCTCCCGGGACCCCCCTGCCCGG - Intronic
1143037689 17:4009111-4009133 CCTGGCGGGAGCCAGGTGCCCGG + Intronic
1144846868 17:18224771-18224793 CCTGTCCCCACCCACCTCCCAGG - Intergenic
1145941275 17:28744450-28744472 CCGGGCGGGTCCCAACTGCCCGG + Intronic
1146548284 17:33757856-33757878 CCTCTCAGCACACACCTGCCTGG - Intronic
1146603246 17:34236304-34236326 CTGATGGGGACCCACCTGCCAGG - Intergenic
1147537112 17:41328173-41328195 CGGGTCAGGCCCCACCTGCCTGG - Intergenic
1151536478 17:74741741-74741763 GCTGTAGAGCCCCACCTGCCAGG - Intronic
1151625038 17:75271129-75271151 GGAGCCGGGACCCACCTGCCGGG + Exonic
1151681694 17:75625911-75625933 CCTGTCCGGACCCACTCTCCTGG + Intergenic
1151947853 17:77329304-77329326 GCTGGATGGACCCACCTGCCTGG + Intronic
1152195946 17:78918439-78918461 CCTCCCAGGGCCCACCTGCCTGG - Intronic
1152932322 17:83116163-83116185 CCTGTGGTCACCCAGCTGCCAGG - Intergenic
1153623506 18:7002249-7002271 CCTGTGGGGACTCACCTGGCAGG + Exonic
1155150377 18:23118204-23118226 CCTTCCTGGACCCACCTTCCTGG - Intergenic
1157623108 18:49027283-49027305 CCTGAAGGGGCCCACCCGCCTGG - Intergenic
1160645877 19:193211-193233 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
1161027758 19:2044491-2044513 CCTGCTGGGACCCTCCTGCCAGG + Intronic
1161542677 19:4861440-4861462 CCTGCCTGGCCCCACCTTCCAGG + Intronic
1162580766 19:11528958-11528980 CCTGGAGGGACCCAGCTGCAGGG - Intronic
1163822453 19:19503798-19503820 CCTGGCAGGACCCAGTTGCCAGG + Intronic
1164001120 19:21100288-21100310 CCTGAGGGGATCCACCTCCCTGG - Intronic
927965527 2:27265234-27265256 CCTGCCGGGAGCCACCAGGCGGG + Intronic
929553122 2:42906749-42906771 AATGTCGGGACTCTCCTGCCAGG + Intergenic
931321704 2:61178925-61178947 CCAGCTGGGATCCACCTGCCTGG - Exonic
933727441 2:85434877-85434899 CCTGGCAGGACCCACCAGCCAGG - Exonic
937325043 2:120985319-120985341 CCTGTCCGGGCCCACCTGCCTGG - Intronic
941008306 2:160270055-160270077 CCTGTCGGGGCACACAGGCCTGG - Intronic
948641680 2:239379259-239379281 CTTGCAGGGACCCACCTTCCTGG - Intronic
948887414 2:240891187-240891209 TCTCTGGGAACCCACCTGCCTGG + Intronic
948890030 2:240903117-240903139 CTTGTCCTGCCCCACCTGCCTGG - Intergenic
1168916345 20:1491326-1491348 GATGTCGGCCCCCACCTGCCTGG - Exonic
1171398985 20:24859403-24859425 CCTTGCGGGACCCACCAGGCAGG + Intergenic
1172077977 20:32314305-32314327 CCTCAAGGGATCCACCTGCCTGG - Intronic
1172303491 20:33865649-33865671 GATGTCAGTACCCACCTGCCCGG + Intergenic
1174168855 20:48604049-48604071 CCTGTGTGCACCCACCAGCCAGG + Intergenic
1175333253 20:58178908-58178930 CCAGTCTGGACCCACATCCCAGG - Intergenic
1175853699 20:62107504-62107526 CCTGCCGGTCCCTACCTGCCTGG + Intergenic
1176279629 20:64293005-64293027 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
1176412944 21:6458535-6458557 CCTGTGGGGCGTCACCTGCCCGG + Intergenic
1178707257 21:34886561-34886583 CCGGTCGGGACCTCCCTGGCAGG - Intronic
1179688438 21:43066857-43066879 CCTGTGGGGCGTCACCTGCCCGG + Intronic
1180226816 21:46398479-46398501 CCTCTGGGGAACCACGTGCCAGG - Intronic
1180876812 22:19178565-19178587 CCCGGAGGGGCCCACCTGCCAGG + Exonic
1181048439 22:20227558-20227580 CCTGCTGGTTCCCACCTGCCTGG + Intergenic
1181368477 22:22398272-22398294 CCAGACGGGAGCCACCTGCTAGG + Intergenic
1181668871 22:24416573-24416595 CCTGTCCGGATCCAGCTGTCTGG + Exonic
1183978638 22:41527213-41527235 CCTGTCTGGCCCTACCTGCCTGG - Exonic
1184884526 22:47334415-47334437 CCTGCTGGGACCCACCACCCGGG + Intergenic
1185040133 22:48499687-48499709 CCTGTGGGCAGCCTCCTGCCTGG + Intronic
1185236543 22:49716756-49716778 GCTGCTGGGCCCCACCTGCCTGG - Intergenic
1185252452 22:49811578-49811600 CCTGTCGTGTCCTGCCTGCCGGG - Intronic
1185344946 22:50307061-50307083 CCTGGCGAGACCCCACTGCCTGG - Intronic
950020038 3:9780549-9780571 CCTGTGGGGACCAGCCAGCCAGG + Exonic
950164150 3:10780933-10780955 CCTCTCGGGACCCTCCAGGCTGG - Intergenic
950538535 3:13595650-13595672 CCTGTCACCACCCTCCTGCCAGG + Intronic
950583474 3:13878137-13878159 CCTGCGGGGGCCCAGCTGCCCGG - Intronic
951482660 3:23178379-23178401 CCTCAGGTGACCCACCTGCCTGG + Intergenic
951544543 3:23810997-23811019 CCTGTCGGGGGCGCCCTGCCGGG + Intronic
952144538 3:30517540-30517562 CCTCTGGTGATCCACCTGCCTGG + Intergenic
953606335 3:44415500-44415522 CCTGTGGTGACCTCCCTGCCTGG - Intergenic
954608678 3:51932896-51932918 CCTGCCAGGACCTACCTGCCAGG - Intergenic
954675712 3:52314318-52314340 CCTGTTGGTCCCCACCTTCCTGG - Intergenic
960966031 3:123105322-123105344 CTGGTAGGCACCCACCTGCCTGG - Intronic
961664788 3:128488539-128488561 CCTTTCTGGAGCCACCGGCCGGG - Intronic
962343723 3:134605216-134605238 CCCATGAGGACCCACCTGCCTGG + Intronic
967214341 3:187197797-187197819 CCTGCAGGGATCCACCTTCCTGG - Intronic
968371804 3:198226315-198226337 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
969588379 4:8107548-8107570 CCGGGCAGGACCCAGCTGCCCGG + Intronic
976306636 4:83566269-83566291 CCTCAGGTGACCCACCTGCCTGG + Intronic
979260492 4:118638793-118638815 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
983784916 4:171718571-171718593 CCTGTCTGTACCCACTTGCAGGG + Intergenic
985260061 4:188106682-188106704 CCTGCAGGGACGCGCCTGCCAGG - Intronic
985529197 5:423993-424015 GATGTCGGGAGCCCCCTGCCAGG - Intronic
985561314 5:587589-587611 CCTCTCAGTACCCACCTTCCTGG + Intergenic
985644988 5:1080601-1080623 CTTGTCGGGACGCCCCTGACAGG - Intronic
985658785 5:1145318-1145340 CCTGTGGGGACACAGCTGCTGGG + Intergenic
985773504 5:1827648-1827670 CCTGTGGGGCCCCCCCTCCCCGG + Intergenic
986754933 5:10826673-10826695 TCTGTGGGGACCCTCCTGCAAGG + Intergenic
987254184 5:16132325-16132347 ACTGTTGGGACCCACCTGGCTGG - Intronic
997733698 5:136198548-136198570 CCTGTTAGGAGCCCCCTGCCAGG + Intergenic
998369888 5:141654138-141654160 CCTCTAGGGACCCCCGTGCCTGG + Exonic
1001229221 5:169971295-169971317 CCTGTCAGGCCCCAGCTCCCCGG - Intronic
1001245933 5:170105924-170105946 GCTGGCCGGAGCCACCTGCCTGG - Exonic
1001333292 5:170777458-170777480 CCAGTCAGGACCCATTTGCCTGG + Intronic
1002688563 5:181034714-181034736 CCTGTCAGGACCCATCGGCCTGG - Intergenic
1002731045 5:181331861-181331883 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
1002753489 6:142243-142265 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
1002924019 6:1594627-1594649 CCAGCCGGGACCCACCTCGCAGG + Intergenic
1004305158 6:14494171-14494193 CCTCTGGTGATCCACCTGCCTGG + Intergenic
1007608970 6:43136604-43136626 CCTCTCGGAACCCAGCTGCCAGG - Intronic
1007735765 6:43981424-43981446 TCTGGCTGGCCCCACCTGCCTGG - Intergenic
1007809337 6:44475268-44475290 CCTGTCGTCAGCCACCTCCCTGG - Intergenic
1007825819 6:44599908-44599930 CCTGTGGGCCCCCAGCTGCCTGG + Intergenic
1013368131 6:109449828-109449850 CCTGTCAGCACCCACCTCTCAGG + Intronic
1018736118 6:166688360-166688382 CCACTCGTGTCCCACCTGCCCGG + Intronic
1024064604 7:45722001-45722023 CCTGTGGGCATCCACCTCCCAGG + Exonic
1024076188 7:45819023-45819045 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
1025176594 7:56805310-56805332 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
1025729931 7:64100205-64100227 CCTCACGCGACCCACCCGCCGGG + Intronic
1025958823 7:66203335-66203357 GCTCACGGGACCCTCCTGCCTGG + Intergenic
1026361474 7:69604754-69604776 CCTGTGGAGACCCACATGCCAGG + Intronic
1026702498 7:72659344-72659366 CCTCTGGTGATCCACCTGCCTGG - Intronic
1028021896 7:85787079-85787101 CCTCAAGGGATCCACCTGCCTGG - Intergenic
1035204527 7:157286397-157286419 ACTGCAGGGTCCCACCTGCCAGG - Intergenic
1035445119 7:158935958-158935980 CCTCAGGTGACCCACCTGCCTGG - Intronic
1035446627 7:158947683-158947705 CCTGACGTGAGCCTCCTGCCTGG + Intronic
1036806266 8:11836432-11836454 GTTGTGGGGACCCACGTGCCAGG - Intronic
1038417462 8:27407629-27407651 CCTGGGGAGACCCACCTCCCGGG - Intronic
1038637114 8:29296383-29296405 CCTGTGAGGACACGCCTGCCAGG + Intergenic
1040057641 8:43074289-43074311 CCTCACGGGATCCACTTGCCTGG - Intronic
1040549871 8:48429624-48429646 CATGTCGGGATCCACCTTACAGG - Intergenic
1042355449 8:67823019-67823041 CCTGTTGGGACTCAATTGCCTGG - Intergenic
1042484602 8:69336647-69336669 CCCACCGGGACCCACCTCCCAGG - Intergenic
1046292527 8:112181539-112181561 CCTGATGTGATCCACCTGCCTGG - Intergenic
1049111159 8:140644474-140644496 CCTGTTGGGACCAAGCTGCTGGG - Intergenic
1049536373 8:143184282-143184304 CCTTCCAGGACACACCTGCCTGG - Intergenic
1049813922 8:144589336-144589358 CCTGCCGGGACACGCCTGCATGG - Intronic
1053149311 9:35732610-35732632 CCTCTCCGGACCCGCCTCCCAGG - Exonic
1054332619 9:63775159-63775181 CCTGTAGGGACCCGAGTGCCTGG + Intergenic
1060816529 9:126638192-126638214 CCTGTCGGGACCCACCTGCCAGG - Intronic
1060825031 9:126683044-126683066 GCTGTCGGGAGCCCCCAGCCGGG - Intronic
1060874817 9:127075125-127075147 CCTCTTGGGAAGCACCTGCCAGG - Intronic
1062048237 9:134434200-134434222 CGGGGCGGGACCCACCTTCCCGG - Exonic
1062755450 9:138284368-138284390 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
1186486643 X:9938791-9938813 CCTGTCGGCGCCCTCCTGCCTGG - Intronic