ID: 1060816532

View in Genome Browser
Species Human (GRCh38)
Location 9:126638205-126638227
Sequence TCCCGACAGGAATGCTCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060816521_1060816532 8 Left 1060816521 9:126638174-126638196 CCCCTCTCTGCTGGTGTCCCTGG 0: 1
1: 1
2: 10
3: 53
4: 480
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816529_1060816532 -10 Left 1060816529 9:126638192-126638214 CCTGGCAGGTGGGTCCCGACAGG 0: 1
1: 0
2: 1
3: 20
4: 186
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816518_1060816532 18 Left 1060816518 9:126638164-126638186 CCCAGGTGAGCCCCTCTCTGCTG 0: 1
1: 0
2: 8
3: 21
4: 261
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816517_1060816532 23 Left 1060816517 9:126638159-126638181 CCTGGCCCAGGTGAGCCCCTCTC 0: 1
1: 0
2: 3
3: 72
4: 656
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816524_1060816532 6 Left 1060816524 9:126638176-126638198 CCTCTCTGCTGGTGTCCCTGGCA 0: 1
1: 0
2: 3
3: 61
4: 349
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816523_1060816532 7 Left 1060816523 9:126638175-126638197 CCCTCTCTGCTGGTGTCCCTGGC 0: 1
1: 0
2: 5
3: 39
4: 430
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816528_1060816532 -9 Left 1060816528 9:126638191-126638213 CCCTGGCAGGTGGGTCCCGACAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data
1060816519_1060816532 17 Left 1060816519 9:126638165-126638187 CCAGGTGAGCCCCTCTCTGCTGG 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060816532 Original CRISPR TCCCGACAGGAATGCTCCGG TGG Intronic
No off target data available for this crispr