ID: 1060817075

View in Genome Browser
Species Human (GRCh38)
Location 9:126640629-126640651
Sequence CTGGCCTCCTTGGGAAGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060817064_1060817075 2 Left 1060817064 9:126640604-126640626 CCCACCTGTACCTCTCCTTCTTG 0: 1
1: 0
2: 0
3: 25
4: 322
Right 1060817075 9:126640629-126640651 CTGGCCTCCTTGGGAAGGGTAGG No data
1060817063_1060817075 10 Left 1060817063 9:126640596-126640618 CCTCTGTACCCACCTGTACCTCT 0: 1
1: 0
2: 2
3: 40
4: 441
Right 1060817075 9:126640629-126640651 CTGGCCTCCTTGGGAAGGGTAGG No data
1060817066_1060817075 -2 Left 1060817066 9:126640608-126640630 CCTGTACCTCTCCTTCTTGTCCT 0: 1
1: 0
2: 4
3: 44
4: 466
Right 1060817075 9:126640629-126640651 CTGGCCTCCTTGGGAAGGGTAGG No data
1060817068_1060817075 -8 Left 1060817068 9:126640614-126640636 CCTCTCCTTCTTGTCCTGGCCTC 0: 1
1: 0
2: 5
3: 55
4: 578
Right 1060817075 9:126640629-126640651 CTGGCCTCCTTGGGAAGGGTAGG No data
1060817062_1060817075 25 Left 1060817062 9:126640581-126640603 CCAAGGGTATCTCTGCCTCTGTA 0: 1
1: 0
2: 0
3: 44
4: 378
Right 1060817075 9:126640629-126640651 CTGGCCTCCTTGGGAAGGGTAGG No data
1060817065_1060817075 1 Left 1060817065 9:126640605-126640627 CCACCTGTACCTCTCCTTCTTGT 0: 1
1: 0
2: 1
3: 31
4: 472
Right 1060817075 9:126640629-126640651 CTGGCCTCCTTGGGAAGGGTAGG No data
1060817061_1060817075 30 Left 1060817061 9:126640576-126640598 CCAGGCCAAGGGTATCTCTGCCT 0: 1
1: 0
2: 1
3: 17
4: 217
Right 1060817075 9:126640629-126640651 CTGGCCTCCTTGGGAAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060817075 Original CRISPR CTGGCCTCCTTGGGAAGGGT AGG Intronic
No off target data available for this crispr