ID: 1060817986

View in Genome Browser
Species Human (GRCh38)
Location 9:126645390-126645412
Sequence CCTGAAGTACAGCAGGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060817986_1060817991 -2 Left 1060817986 9:126645390-126645412 CCAAATCCCTGCTGTACTTCAGG 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1060817991 9:126645411-126645433 GGTCTGTCCTCCAGCCAGGCAGG No data
1060817986_1060817990 -6 Left 1060817986 9:126645390-126645412 CCAAATCCCTGCTGTACTTCAGG 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1060817990 9:126645407-126645429 TTCAGGTCTGTCCTCCAGCCAGG No data
1060817986_1060817992 -1 Left 1060817986 9:126645390-126645412 CCAAATCCCTGCTGTACTTCAGG 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1060817992 9:126645412-126645434 GTCTGTCCTCCAGCCAGGCAGGG No data
1060817986_1060817994 5 Left 1060817986 9:126645390-126645412 CCAAATCCCTGCTGTACTTCAGG 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1060817994 9:126645418-126645440 CCTCCAGCCAGGCAGGGAGCAGG No data
1060817986_1060817995 6 Left 1060817986 9:126645390-126645412 CCAAATCCCTGCTGTACTTCAGG 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1060817995 9:126645419-126645441 CTCCAGCCAGGCAGGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060817986 Original CRISPR CCTGAAGTACAGCAGGGATT TGG (reversed) Intronic
900173197 1:1280638-1280660 CCTGAATTCCAGCAGGGAGGAGG + Exonic
900967941 1:5972332-5972354 CCTCAAAGACAGCAGGGATCGGG + Intronic
901635895 1:10670027-10670049 CCTGATATACAGCGGGCATTAGG - Intronic
903647204 1:24902666-24902688 CCTGGAGGACAGCAGGGAAGAGG + Exonic
903827329 1:26155657-26155679 CCAGAAGTGCAGCAAGGAGTTGG + Intergenic
905872010 1:41409843-41409865 CCTGGAGTACAGCAGAGAATGGG + Intergenic
905925355 1:41745734-41745756 CCTGAATTAGAGCAGGGTTGTGG + Intronic
906614002 1:47222873-47222895 CCTGAAGTTCCCCAGGGATGAGG - Intronic
909396105 1:75172585-75172607 TCTGAGGTTCAGCAGGAATTTGG + Intergenic
909473430 1:76055633-76055655 CCTGAACTACAGAAGTGGTTTGG + Intergenic
912237043 1:107863528-107863550 CTTGAGGTCCAGCAGAGATTGGG - Intronic
912470899 1:109906081-109906103 CCTGGAGTAGAGAAGAGATTGGG - Intergenic
912711292 1:111951924-111951946 ACAGAAAGACAGCAGGGATTTGG + Intronic
915702695 1:157811285-157811307 ACTGAAGTACAGCAGGGGAATGG + Intronic
915958019 1:160239620-160239642 TCTGAACTGCAGCATGGATTGGG - Intronic
916106135 1:161433833-161433855 CCTGAAGGACAGCAGTGAAGAGG - Intergenic
916713637 1:167432835-167432857 CCTGGAGCACAGCTGGGACTTGG - Intronic
917457287 1:175195992-175196014 CCTGAAATATAGCAGTGCTTTGG + Intergenic
1063009348 10:2007416-2007438 CCTGAAGCAGAGGAGGGAGTGGG - Intergenic
1065896221 10:30165139-30165161 CCTGCAGTAAAGCAAGGCTTAGG - Intergenic
1066456739 10:35578830-35578852 CCTGGGGTTCAGCAGGGAATGGG - Intergenic
1071742475 10:88375884-88375906 CCTGAGGTACAGAAAGGAGTAGG + Intronic
1072795977 10:98354863-98354885 CCAGAAGTACAGAAGGGGTGAGG + Intergenic
1074747220 10:116546858-116546880 CCTGCAGTACAGCAAGGATGGGG + Intronic
1074751123 10:116588304-116588326 CCTGAAGGAAAGCAGATATTTGG + Intergenic
1075185076 10:120248570-120248592 CCTAGAGAAGAGCAGGGATTTGG + Intergenic
1075472783 10:122705350-122705372 TTTGAAGTACAGGAGGGCTTGGG + Intergenic
1075746044 10:124728375-124728397 TCTGAAGTACAGCAGAGCCTGGG + Intronic
1076174947 10:128361124-128361146 CCTGAAGTCCAACAGGGAAGTGG - Intergenic
1079029897 11:16978906-16978928 CCTGAACTGCAGCAGGGTGTGGG - Intronic
1080392461 11:31861037-31861059 CCTGAATACCAGCAGGGACTAGG - Intronic
1081871880 11:46386611-46386633 CATGAACTACAGGAGGGAATGGG + Intergenic
1083166711 11:60892978-60893000 CCTGAACTGCAGAAGGGAGTAGG - Intronic
1083476890 11:62920916-62920938 CCTGAGGCCCAGAAGGGATTAGG - Intronic
1084080095 11:66817200-66817222 TCTGATGTACAGCAAGGCTTGGG + Intronic
1084520604 11:69660260-69660282 CCTGAGGGAAAGCAGGGAATGGG + Intronic
1086080791 11:82900742-82900764 CCTGAAGGACAGGTGGGCTTCGG - Intronic
1086387883 11:86328147-86328169 CCTGAAATAGAGCAGGGATTAGG + Intronic
1086834182 11:91600828-91600850 TCTGAAGGACAGCAGTGAATGGG + Intergenic
1086917822 11:92551172-92551194 CCTCAATTACAGCAGGTATCTGG + Intronic
1089764289 11:120751765-120751787 CCGGAAGCCCAGCAGGGCTTGGG - Intronic
1090335596 11:125961105-125961127 CCTGAAACACAGCAGGGTTTGGG + Exonic
1090860558 11:130648863-130648885 CCAGAAGTACAGCAAGGCTGGGG - Intergenic
1091361661 11:134982751-134982773 CCTGGAGCTCAGCTGGGATTTGG + Intergenic
1096956611 12:55532446-55532468 CCTGAAAGCCAGAAGGGATTGGG + Intergenic
1097141766 12:56908402-56908424 CCTGAAGCAGAGCTGGGTTTGGG + Intergenic
1098199855 12:68043088-68043110 CCTGAAATACAGCAGGGTCCTGG + Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1099526426 12:83723546-83723568 CCTGAAGGACAGCAGGGAAGGGG + Intergenic
1100085848 12:90909507-90909529 GATGAAGTACAGCAGGTATCAGG + Intronic
1100263698 12:92956051-92956073 CCTGAAGTAGAACTGGAATTAGG + Intergenic
1104342062 12:127959531-127959553 CCTAAAGGACATCAGGGATCAGG - Intergenic
1104380976 12:128307880-128307902 CCTAAAGTAAAGCAGGGTGTTGG - Intronic
1105740181 13:23315618-23315640 CCTGAAGGACAGCAGTGAAGGGG + Intronic
1107021953 13:35761026-35761048 CCTGATTTACAGCAGGACTTTGG + Intergenic
1107056480 13:36110020-36110042 TCTGAAGTGCAGCAGGGAGAGGG + Intronic
1108179470 13:47826609-47826631 CCTGAAGTCCGGCAGTGACTTGG + Intergenic
1108573572 13:51772279-51772301 CCTGAAGTACAGCAGTGAACAGG - Intronic
1108699211 13:52929415-52929437 CCTGAAGTCCATCAGGGAACAGG - Intergenic
1112218217 13:97458528-97458550 TCTGAAGTTCAGCAGGGTTTAGG - Intronic
1113301144 13:109020671-109020693 CATTAACTACAGCTGGGATTTGG - Intronic
1118077353 14:62314539-62314561 CCTGAAGAACAGACGGAATTGGG + Intergenic
1118207885 14:63740197-63740219 CCTGAGGAACAGCAGGTACTTGG + Intergenic
1119828181 14:77675655-77675677 CCTGAATGACAGCAAGGGTTTGG + Exonic
1121680924 14:95792157-95792179 CTAGAAGTAAAGTAGGGATTAGG + Intergenic
1122052983 14:99072870-99072892 CCTGCAGTACAGCGGGTGTTTGG - Intergenic
1122999746 14:105286982-105287004 CCTGCAGTCCAGCAGGGAGGTGG - Intronic
1123677936 15:22730684-22730706 CTTGATGTCCAGCAGGGATTGGG + Intergenic
1124330133 15:28804951-28804973 CTTGATGTCCAGCAGGGATTGGG + Intergenic
1124342902 15:28901467-28901489 CCTTCAGCACAGCTGGGATTTGG + Intronic
1129075968 15:72996437-72996459 CCTGAGCTACAGAAGGGAATAGG + Intergenic
1130809849 15:87365383-87365405 CCTGTGGTACAAAAGGGATTGGG + Intergenic
1132435569 15:101798866-101798888 CCTGAAGTATAGTAGATATTTGG - Intergenic
1134674094 16:16077234-16077256 CATAAAATACAGCAGTGATTTGG - Intronic
1136107125 16:28037943-28037965 CATGACCTACAGGAGGGATTGGG - Intronic
1136537813 16:30910622-30910644 CCTGCAGAACAGCAGGGAGCGGG - Intergenic
1137469045 16:48738193-48738215 ACTGAGGTACAGCAGGGAGAAGG - Intergenic
1137704090 16:50521882-50521904 CTTGCATTACAGCAGGGCTTGGG + Intergenic
1139563859 16:67760632-67760654 GAAGAACTACAGCAGGGATTGGG - Intronic
1140860356 16:79012764-79012786 CCTGAAACACAGCAGGTATTCGG + Intronic
1140990401 16:80205341-80205363 CCTGAGAGACAGCAGGGACTAGG - Intergenic
1142147294 16:88497926-88497948 CCTGATGGACAGCAGGGAGATGG + Intronic
1143303703 17:5929573-5929595 CCTGAACAACAAGAGGGATTTGG + Intronic
1143970599 17:10792435-10792457 CCTGAGGCTCAGCAGGGCTTGGG + Intergenic
1148204025 17:45768381-45768403 CCTAATATACAGCAGGGAGTCGG + Intergenic
1150485885 17:65543481-65543503 TCTGACGTACAGTAGGGACTCGG - Intronic
1154493645 18:14940178-14940200 CCTGGAGCTCAGCTGGGATTTGG - Intergenic
1157584215 18:48790938-48790960 GCTGAGGGAGAGCAGGGATTGGG - Intronic
1158534497 18:58295519-58295541 ACTGAAGGACAGCTGGGTTTTGG + Intronic
1161982341 19:7636727-7636749 CCTGAAGTACAGAAGGCAAGTGG + Intronic
1163564990 19:18045755-18045777 CCTAAAGCACAGCAGGCATCTGG + Intergenic
1165448075 19:35867813-35867835 CCTGAAGTGGAGCAGGGAAGGGG + Intronic
1166257233 19:41615239-41615261 TCTGATGAACAGCAGGTATTAGG - Intronic
1167606071 19:50481791-50481813 CCTGAGGGCCAGCAGGGAGTGGG - Intronic
1168620627 19:57876712-57876734 CCTGCAGTAAAGCAGGTGTTGGG + Intronic
925946997 2:8874536-8874558 TCTGAAGTAGGGCAGGGATATGG + Intronic
926197441 2:10772425-10772447 CCTGAAGGTGAGCAGGGATGGGG - Intronic
929664985 2:43826969-43826991 CCTGAAGTGTGGCAGGCATTTGG + Intronic
929778657 2:44943787-44943809 CCTGAAGTACACCAGGCCCTGGG - Intronic
929942873 2:46348121-46348143 CCTGTAGTACAGGAAGGATATGG + Intronic
930056221 2:47254137-47254159 CCTGGAGTAGAGCTGGGAATGGG - Intergenic
930696348 2:54415948-54415970 TCAGGAGGACAGCAGGGATTAGG - Intergenic
932565184 2:72901728-72901750 CCTGGAATACAACAGGGCTTTGG + Intergenic
932882185 2:75513064-75513086 CCTGAACAACAGCAGCCATTTGG + Intronic
937037882 2:118796844-118796866 CCTGAAGTCCAAAAGGAATTTGG - Intergenic
937867249 2:126761768-126761790 CCTGAAGGACAGCAAGGGTCAGG - Intergenic
938081430 2:128372342-128372364 TCTGAAGGACAGCAGGGAGGTGG - Intergenic
939546954 2:143566413-143566435 CCGGAAGTACAGCAGTGACTAGG + Intronic
942869535 2:180718024-180718046 GTTAAGGTACAGCAGGGATTTGG - Intergenic
945713062 2:213324235-213324257 CTTGAGGTACAGTAGGGAATGGG - Intronic
947795023 2:232889194-232889216 CGTGCTGTTCAGCAGGGATTTGG - Intronic
1169342345 20:4805963-4805985 CCAGAAGTACAGCAGGCCTGGGG + Intronic
1173713509 20:45180970-45180992 CCTGAATTCCAGAAGGGAATCGG - Intergenic
1175871824 20:62212873-62212895 CCGGAAGGAGAGCAGGGATGGGG + Intergenic
1175909295 20:62396998-62397020 CCTGAAGCACAGCTGGGCATTGG + Intronic
1180064998 21:45407881-45407903 TCTGAAGCCCTGCAGGGATTGGG + Intronic
1181428406 22:22858944-22858966 CCTGAATTAAAGCATGGCTTTGG - Intronic
1182793018 22:32968708-32968730 CCTGATGTGCAGCTGGGTTTGGG - Intronic
1182956225 22:34429205-34429227 ACTGAAGAACAGCAGGCTTTGGG - Intergenic
1183185551 22:36289624-36289646 CCTGAACCACAGCTGGCATTTGG + Intronic
1184095213 22:42312697-42312719 CCTGAGGCTCAGCAGGGATGGGG - Intronic
1184442637 22:44527291-44527313 CCTGGAATAGAGCAGGGCTTTGG + Intergenic
1184790295 22:46695887-46695909 CCAGCAGGACAGCAGGGACTGGG + Intronic
949704802 3:6803992-6804014 TCTGCAGTACATCAGTGATTTGG + Intronic
950626197 3:14248899-14248921 CCTGATGCACACCAGGCATTGGG - Intergenic
951695188 3:25438991-25439013 CCTGAGCTACAGCAGTGACTAGG - Intronic
952488596 3:33842120-33842142 CTTGATGTCCAGCAGGGATTGGG + Intronic
952915252 3:38233075-38233097 CCTGGAGTGCAGCATGGAGTGGG - Intronic
953296999 3:41729095-41729117 GCTGAAGTACAGCAGGGGAGTGG + Intronic
953565261 3:44026939-44026961 CCTGAAGGAGAGCAGGGAGATGG - Intergenic
954797574 3:53169278-53169300 CCTGAAGTTCAGGAGGGTCTGGG + Intronic
955650945 3:61193217-61193239 CTTGGAGTACAGTAAGGATTGGG + Intronic
958790081 3:98642343-98642365 CCTGCAAGACAGAAGGGATTAGG - Intergenic
959136233 3:102425115-102425137 CTTGAAGAAGAGCAGAGATTAGG - Intronic
959902668 3:111677394-111677416 CCTGAAATATAGTAGGCATTTGG + Intronic
960985584 3:123278506-123278528 CCTGGCATACAGCAGGCATTTGG - Intergenic
962625138 3:137218527-137218549 CCTGAAATACTGCAGGGGTTTGG + Intergenic
963698941 3:148599926-148599948 CCTGAAGAGCAGCAGGACTTAGG - Intergenic
964762238 3:160145546-160145568 TCTGGAGTACAGCAGAGATCAGG + Intergenic
968250367 3:197205150-197205172 CCAGAAGTAAAGCCTGGATTAGG + Intronic
968312005 3:197691705-197691727 CCTGCAGCAAAGCAGGGATCCGG - Intronic
968691284 4:1991766-1991788 CCGGAAGCTCAGCAGGGAGTGGG - Intronic
969107144 4:4816056-4816078 GCCAAAGAACAGCAGGGATTTGG + Intergenic
971524298 4:27596816-27596838 CCTGAAGTAGAGAAGAAATTGGG + Intergenic
975448125 4:74491904-74491926 CCTGAAGCAGAGCATGGCTTTGG - Intergenic
976470266 4:85420136-85420158 TCTGAAATACAGCAGGCAATTGG - Intergenic
977959959 4:103074423-103074445 CCTGATGAACAGCAGTGATGAGG + Intronic
978130702 4:105193165-105193187 CCTGAAGGACAGGAAGAATTGGG + Intronic
978967448 4:114758311-114758333 CCTGAGGTACAATAGAGATTTGG + Intergenic
979461768 4:120991949-120991971 CCTGAAAGCCAGAAGGGATTGGG - Intergenic
979712524 4:123796964-123796986 CCTAAAATCCAGAAGGGATTAGG - Intergenic
980806170 4:137816984-137817006 TCTGAAGTACACTAGGGATTAGG - Intergenic
982093005 4:151896690-151896712 CCAGAAGTACAAGAGGGAATAGG + Intergenic
985212665 4:187612011-187612033 CCTGAGGCAGAGCAGGGCTTCGG - Intergenic
985332532 4:188855249-188855271 CGTGAAGTACAGCCAGGATAAGG - Intergenic
987222912 5:15808769-15808791 CCTGACACACAGCAGGGACTCGG + Intronic
993699226 5:91098555-91098577 CCAGAAGTACAACAATGATTAGG - Intronic
993791846 5:92219344-92219366 CCTGAAGGACAGCAGTGAAGGGG + Intergenic
994009104 5:94879055-94879077 CCTCAAGCACAGCAGGCTTTTGG - Intronic
994625363 5:102211768-102211790 CCTGAAGTACGGTATCGATTAGG - Intergenic
994720711 5:103376815-103376837 AATGAACTACAGCAGGGATCAGG - Intergenic
996821520 5:127634061-127634083 CCAGAAGTCCAGTATGGATTAGG - Intergenic
999354403 5:150911123-150911145 CATGGAGAGCAGCAGGGATTTGG + Intergenic
1001919819 5:175591028-175591050 CCTGCTGTACACCAGGGCTTGGG - Intergenic
1004285933 6:14320781-14320803 CCAGAAGTACAGCTTGGATTTGG - Intergenic
1007121058 6:39381890-39381912 TCTGAATTACAGCAGGTGTTAGG - Intronic
1007385304 6:41516501-41516523 CCTGAAGTAGGGCAGGGAAGGGG - Intergenic
1010025552 6:71212404-71212426 TCTGAGGTACAACAGGGGTTAGG - Intergenic
1013050540 6:106530251-106530273 ACTGAAGAAATGCAGGGATTTGG + Exonic
1015742654 6:136473852-136473874 CCTGGAACACAGCAGGCATTTGG - Intronic
1017276215 6:152572002-152572024 CCTGAATTAAAGAAGGGGTTGGG + Intronic
1017499798 6:155013180-155013202 CCTGTAGTACAGCTGAGGTTTGG + Intronic
1021210586 7:17847653-17847675 CCTAAAGGAGAGCAGAGATTTGG - Intronic
1021831722 7:24618811-24618833 GCCGAAGTACAGCAGGGAAGTGG - Intronic
1022371611 7:29776865-29776887 CCTCAAGTACGGCAGTGAGTTGG + Intergenic
1035078916 7:156200161-156200183 CCTGAACTACAGCTTGGATGTGG - Intergenic
1037415107 8:18641247-18641269 CCTGGAGGAGAGCAGGGACTTGG - Intronic
1038417292 8:27406448-27406470 CCAGATGTACAGCAGTGAGTGGG + Intronic
1038779730 8:30559576-30559598 TCTGAATTACAGAAGGCATTTGG - Intronic
1040493910 8:47949268-47949290 CATGAAGCATAACAGGGATTAGG + Intronic
1040729295 8:50422951-50422973 CCTGAATTACATCTGGGCTTAGG - Intronic
1041787995 8:61657202-61657224 CCTGAAGGAAATCAGGGATGTGG + Intronic
1042497601 8:69472208-69472230 CCTGTACCATAGCAGGGATTTGG + Intronic
1044933233 8:97270082-97270104 CCTGAACTACAGCATGCATGTGG - Intergenic
1048830883 8:138476341-138476363 CCTGATGTAAACCATGGATTTGG + Intronic
1053464264 9:38293699-38293721 TCTGAAGTTCAGCTGGGAATTGG - Intergenic
1055653656 9:78432752-78432774 CCTAAAGAACAGGTGGGATTTGG - Intergenic
1056622327 9:88224708-88224730 GATGAAGTTCAGCAGGGATGTGG - Intergenic
1056856604 9:90135016-90135038 GCTGGAGTAGAGCAGGGATATGG + Intergenic
1060817986 9:126645390-126645412 CCTGAAGTACAGCAGGGATTTGG - Intronic
1061483149 9:130907046-130907068 TCTGAATAGCAGCAGGGATTTGG - Intronic
1187119004 X:16384973-16384995 CATGGAGTACAGCAGTGAATGGG + Intergenic
1189767447 X:44386134-44386156 CTTGAAGTGGAGCAGGGACTTGG - Intergenic
1192325597 X:70129329-70129351 CCTGAACTACAGAAAGGAATAGG + Intergenic
1195007184 X:100697340-100697362 ACTAAAGTACAGCTGGGAATGGG + Intronic