ID: 1060820124

View in Genome Browser
Species Human (GRCh38)
Location 9:126656859-126656881
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 8, 1: 36, 2: 75, 3: 124, 4: 395}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060820117_1060820124 -1 Left 1060820117 9:126656837-126656859 CCGCATCCCCCAGTCCATGGCCA 0: 1
1: 1
2: 4
3: 97
4: 817
Right 1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG 0: 8
1: 36
2: 75
3: 124
4: 395
1060820114_1060820124 22 Left 1060820114 9:126656814-126656836 CCACTCACAGGATGCCACTGGCA 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG 0: 8
1: 36
2: 75
3: 124
4: 395
1060820121_1060820124 -10 Left 1060820121 9:126656846-126656868 CCAGTCCATGGCCATCAAAAATG 0: 1
1: 0
2: 0
3: 10
4: 155
Right 1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG 0: 8
1: 36
2: 75
3: 124
4: 395
1060820118_1060820124 -7 Left 1060820118 9:126656843-126656865 CCCCCAGTCCATGGCCATCAAAA 0: 1
1: 0
2: 3
3: 12
4: 187
Right 1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG 0: 8
1: 36
2: 75
3: 124
4: 395
1060820115_1060820124 8 Left 1060820115 9:126656828-126656850 CCACTGGCACCGCATCCCCCAGT 0: 1
1: 0
2: 1
3: 20
4: 243
Right 1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG 0: 8
1: 36
2: 75
3: 124
4: 395
1060820120_1060820124 -9 Left 1060820120 9:126656845-126656867 CCCAGTCCATGGCCATCAAAAAT 0: 1
1: 0
2: 1
3: 12
4: 193
Right 1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG 0: 8
1: 36
2: 75
3: 124
4: 395
1060820119_1060820124 -8 Left 1060820119 9:126656844-126656866 CCCCAGTCCATGGCCATCAAAAA 0: 1
1: 0
2: 0
3: 15
4: 216
Right 1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG 0: 8
1: 36
2: 75
3: 124
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901591505 1:10347798-10347820 AGCAAAAATGTCCCCTGGCAAGG - Exonic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902039114 1:13480047-13480069 ATCAAAACTGTCTCCAGTCCGGG + Intronic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
903530423 1:24026117-24026139 TACAAAAATGTAGCCAGACATGG - Intergenic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
905217152 1:36416870-36416892 ATGTAAAATGTCTCCAGCCAGGG - Intronic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907211502 1:52827693-52827715 ATTAAAAATGTCTGCAGGCTGGG - Intergenic
907851402 1:58258508-58258530 ATGAAAAATGAGTCCAGACAGGG - Intronic
908304700 1:62800500-62800522 ATTAAAAATGTCTCCTAAAATGG - Intronic
908839732 1:68266899-68266921 ATACAAAATGTCTCCGGAGATGG + Intergenic
909490788 1:76224207-76224229 AAATAAAATCTCTCCAGACAAGG - Intronic
910368952 1:86495916-86495938 ATCAAAAATGTCTCCATATGTGG + Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
910977239 1:92919686-92919708 AGTAAAAATTTATCCAGACAAGG + Intronic
911231096 1:95362528-95362550 AGAAAAGATCTCTCCAGACAAGG + Intergenic
911289335 1:96037959-96037981 AACAAAACTGTCTCCTGCCATGG + Intergenic
911333463 1:96552583-96552605 ATCAAACACATCTGCAGACATGG + Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
914202256 1:145496064-145496086 ATCAAAAATGTCTACAGGCTGGG + Intergenic
914236186 1:145813979-145814001 ATCAAAAATGTCTACAGGCTGGG + Intronic
914481382 1:148069206-148069228 ATCAAAAATGTCTACAGGCTGGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916344355 1:163771277-163771299 ATCAAGAAGGGCTCCACACATGG + Intergenic
917648450 1:177051603-177051625 ATCTAATTTGTCTCCAGCCAAGG + Intronic
917713871 1:177713847-177713869 AGCATAAGTGTCTTCAGACATGG - Intergenic
918199797 1:182256305-182256327 AAAAAAAATAACTCCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918565498 1:185925762-185925784 ATCAAAAAGGTATCCAGAGAAGG + Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921192015 1:212718688-212718710 ATCAAGAAAGTCTCCATAGAGGG - Intergenic
923633075 1:235667816-235667838 TTCAAAAATTTAGCCAGACATGG - Intronic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
924178294 1:241415529-241415551 AGCAATAATGTATCTAGACATGG + Intergenic
1064184670 10:13151047-13151069 ATCAAGAATGTAACCAGACTTGG - Intergenic
1065093304 10:22255929-22255951 AACAAAAATGTTTTCAAACAAGG - Intergenic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1066127662 10:32357612-32357634 ATTAAAAAATTATCCAGACATGG - Intronic
1067111507 10:43404560-43404582 ATCAAAACTACCTCCAGACTGGG + Intronic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1068764602 10:60749062-60749084 ATCAAAACGGTGTCCAGACTTGG - Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1069270728 10:66524122-66524144 ATGAAAAATGTTTCCTGAGACGG - Intronic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1069520660 10:69117570-69117592 ATCAAAACTGTCTCCAGGCCGGG + Intergenic
1070050697 10:72886789-72886811 ATGAACAAAGCCTCCAGACAAGG - Exonic
1070542884 10:77429419-77429441 AACTAAAATGTCTCCCAACATGG + Intronic
1071415449 10:85437050-85437072 ATCCAAAATGTCTGCAGGAATGG - Intergenic
1071542569 10:86500555-86500577 ATCAGAAATATCTCCAATCAAGG - Exonic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1072000926 10:91194944-91194966 ATCACAAATGCCCCCACACATGG - Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1074016106 10:109535776-109535798 ATCAAATCTATTTCCAGACAAGG - Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1074984391 10:118643951-118643973 ATCAGAAGTGGCTCCAGCCACGG - Intergenic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1077592565 11:3503981-3504003 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1077991887 11:7419557-7419579 AACAAAAATGTCTCAAGGCGGGG + Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1078872711 11:15363890-15363912 ATAAAAAATGTCTATGGACATGG - Intergenic
1079415011 11:20225887-20225909 TTCTAAAATGTCTACAGATAAGG + Intergenic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084177469 11:67430727-67430749 ATCAAAAATGTGTCCATGCCAGG - Intronic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084248402 11:67876705-67876727 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084471528 11:69362335-69362357 AACAAAGAAGTCTCAAGACATGG - Intronic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084747446 11:71182149-71182171 AAAAAAAATCTCTCCAAACATGG + Intronic
1084824420 11:71718776-71718798 GTCAAAGTTGTCTCCAGACCAGG + Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085353966 11:75818986-75819008 ATCAAAAATGAGTTCAGACATGG + Intronic
1085700837 11:78744670-78744692 CTCAAAAATGTTTACAGAAAGGG - Intronic
1086329275 11:85737574-85737596 ACCAAATGTGTCTCCAGAGAAGG - Exonic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086522320 11:87683494-87683516 ATCAAAAAAATCTCCCAACAGGG + Intergenic
1087200362 11:95338669-95338691 AACAAAAATGCTGCCAGACAGGG - Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090246578 11:125220499-125220521 ATCGGAGATGGCTCCAGACATGG + Intronic
1090378280 11:126306885-126306907 ATCAAAAATGTCTTCACCGATGG - Intronic
1091618796 12:2069958-2069980 ATTTAAAATGTATCCAGGCATGG - Intronic
1091683307 12:2542192-2542214 ATAAAAAATGACTCCAGAAGGGG - Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092770787 12:11894694-11894716 TTCAAAAATGTATTCAGACTTGG - Exonic
1093199434 12:16169329-16169351 AACAAACATATCTCAAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1093741875 12:22698577-22698599 ATCCAAAATGTTGCCAGAAATGG + Intergenic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1095405007 12:41858113-41858135 ATCACAAATGTAGCCAGAAAAGG - Intergenic
1095990898 12:48033829-48033851 ATCTGAAATGTCACCAGAGATGG + Intergenic
1096856062 12:54484080-54484102 ATCAAAAAATTAGCCAGACAGGG - Intergenic
1097789915 12:63804146-63804168 ATCAAAAACGTCTCCAGGCCAGG - Intronic
1098708019 12:73715964-73715986 AACAAAGATGTCCCCAAACAAGG - Intergenic
1099682774 12:85848980-85849002 AACAAAAATTTATCCAGGCATGG - Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100281232 12:93120175-93120197 ATCATGAATGCCTCCAGACAAGG - Intergenic
1100603815 12:96134599-96134621 ATAAAATATGACTCCAGAAAGGG - Intergenic
1100868618 12:98886372-98886394 ATCAGAAGTGTCTCCATTCATGG - Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101317116 12:103639405-103639427 CTCAAAAATGTTTCCAGGCTGGG + Intronic
1101349404 12:103914737-103914759 ATCATAAATGTTTTCAGACTTGG + Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102596502 12:113996821-113996843 ATAAAAAATGTCTCCAGGCCAGG + Intergenic
1102733594 12:115137097-115137119 ATTAAAAATCTCCCCAGACTTGG - Intergenic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1103289287 12:119831019-119831041 ATCAAAAAATTAGCCAGACATGG - Intronic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105619716 13:22055183-22055205 ATCAAACATGACTCAAAACAAGG - Intergenic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1106838402 13:33660737-33660759 ATAAAGAATGTAGCCAGACATGG - Intergenic
1106951622 13:34890822-34890844 CTAAAAAATGTCTACAGACTGGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109718624 13:66248434-66248456 ATAATAAATGTCTTCAGAAAAGG - Intergenic
1110040925 13:70757388-70757410 TTCATAAATGCTTCCAGACAAGG - Intergenic
1110283878 13:73727081-73727103 GTCAAACATTTCTCCAGAGAAGG - Intronic
1110433318 13:75451522-75451544 ATAAAAAATGTAGCCAGGCATGG + Intronic
1110523124 13:76504458-76504480 CTCATAAATGTCTCCAGATGAGG - Intergenic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112501706 13:99947923-99947945 GTCAAAAATGTCTCCAGGCTGGG - Intergenic
1112805040 13:103155465-103155487 ATCAGAAGGGTCTCCAGATATGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115439113 14:33411476-33411498 AACAAAAATGCCTCCAGGCCGGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116892470 14:50282133-50282155 ATTAAAAATGTCTCTAGGCTAGG - Intronic
1117034591 14:51715150-51715172 TTCAAAAATGTCACAGGACAGGG - Intronic
1117328648 14:54691257-54691279 AGGGATAATGTCTCCAGACAAGG - Intronic
1117975170 14:61290001-61290023 AGGAAAAATGTGTCCAGGCACGG + Intronic
1119047184 14:71329445-71329467 ATAAAAAATTTTTCGAGACAGGG + Intronic
1119222567 14:72920959-72920981 TTCAAAATTGTATCCACACATGG + Intergenic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1122303033 14:100742532-100742554 ATGAAAAATGTCTCCAAGGATGG - Intergenic
1123478634 15:20611459-20611481 ATAAAAAATTTATCCAGGCAAGG - Intergenic
1123639379 15:22388926-22388948 ATAAAAAATTTATCCAGGCAAGG + Intergenic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1125082894 15:35696564-35696586 ATCAAAAAATCCGCCAGACACGG - Intergenic
1125276417 15:37996773-37996795 GTCCAAAATGTCTTCAGACCTGG + Intergenic
1126320145 15:47413244-47413266 ATTGAAAATGTTTCCAGAGATGG - Intronic
1127414687 15:58746602-58746624 AAGAAAAATGTCTTAAGACAAGG + Intronic
1128448778 15:67788684-67788706 ATTAAAAATTTGGCCAGACATGG + Intronic
1129904386 15:79175932-79175954 ATCAAAAATATCTCCAGGTGTGG - Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130110877 15:80963904-80963926 CTGAAAACTGGCTCCAGACAAGG + Intronic
1130385358 15:83406749-83406771 ATCACAACTCTCTCCAGACAAGG - Intergenic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131205092 15:90437832-90437854 TTCAAAAAATTCTCCAGACTGGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1131407914 15:92181802-92181824 ATTAATAATATCTCCAGTCAGGG + Intergenic
1131529319 15:93178660-93178682 AGCCTAAATGTCTCCAGCCACGG - Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132413779 15:101605929-101605951 ATCCAAAGTGTATCCAGCCATGG + Intergenic
1132660952 16:1061331-1061353 CTCTTAAATGTCTCCAGAAATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134004283 16:10807512-10807534 ATGAAAAATGTCTCCTGATGTGG - Intronic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG + Intronic
1134161998 16:11898861-11898883 ATTAAAAATATCTGCAGAAAAGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134851987 16:17486899-17486921 ATTAAAAATGGCCCAAGACAAGG + Intergenic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135232816 16:20725675-20725697 ATCAAAAATGTCCCTAGGCTGGG + Intronic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1136067754 16:27770199-27770221 AACCCAAATGTCCCCAGACAAGG - Intronic
1137262909 16:46845489-46845511 AACAAAAATGTGGCCAGGCACGG + Intergenic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137757018 16:50910485-50910507 ATCAAAAATGTCTCCTGCAGGGG + Intergenic
1137893180 16:52183605-52183627 AACATAAATGTGTACAGACATGG - Intergenic
1138213324 16:55181169-55181191 ATGAAAAATGTTTCCAGGCCAGG + Intergenic
1138969111 16:62123576-62123598 ATCAAAAAAGTATCCAGGCATGG - Intergenic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1139580097 16:67867974-67867996 ATCAGAAATGTGGCCAGGCACGG - Intronic
1140289864 16:73643319-73643341 CTTAAAAATATCTCCAGAAAAGG - Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140934502 16:79658024-79658046 AACAAATATGTCCCCAAACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143187908 17:5021634-5021656 ATAAAAAATGTAGCCAGGCATGG - Intronic
1143317837 17:6046080-6046102 AACCAAAATATCTCCAGGCATGG - Intronic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144043533 17:11434032-11434054 AGAAAAAATGTTTCCAAACAAGG - Intronic
1144636827 17:16915448-16915470 ATCAAAAACTTAGCCAGACATGG + Intergenic
1144662544 17:17080555-17080577 ATCAAGGATGACTCCAGACATGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1144886945 17:18469635-18469657 AAAAAAAATGTGGCCAGACATGG - Intergenic
1145145270 17:20474659-20474681 AAAAAAAATGTGGCCAGACATGG + Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1148832768 17:50445497-50445519 ATCAAAAGTGTCTACAGGCTGGG + Intronic
1149160272 17:53685566-53685588 ATCAAAAAGTTAGCCAGACATGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150801962 17:68290259-68290281 ATATAAAATGTCACCAAACATGG - Intronic
1150990242 17:70249458-70249480 ATAAAAAATTTATCCAGGCATGG - Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151174747 17:72277983-72278005 ATTAAAAATTTAGCCAGACATGG - Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153055917 18:946126-946148 ATTAAAAATGTGGCCAGGCATGG - Intergenic
1153516506 18:5907620-5907642 TTAAAAAATGTCTGCAGACTGGG - Intergenic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1154059131 18:11042403-11042425 ATCTAAAATGTGGCCACACAAGG - Intronic
1154154201 18:11930971-11930993 TTCAATAATGTCTCCATAAAAGG - Intergenic
1155309269 18:24508541-24508563 ATGAAACATGTCCCCATACATGG + Intergenic
1157488964 18:48108998-48109020 CTGAAAAATGTCTCCTGCCAGGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161121215 19:2527810-2527832 AGCACAAATGTCCCCAGACTTGG + Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161880665 19:6949470-6949492 ATCAAAAATGCCTCCAGAGGGGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162331756 19:10034139-10034161 ATGAAAAAACTCTCCAGACTCGG - Intergenic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163454804 19:17400248-17400270 ATTAAAAATGTTTCCAGGCTGGG - Intergenic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1163838974 19:19594113-19594135 ATTAAAAATGTCGCCGGGCATGG + Intronic
1164144511 19:22503745-22503767 CTCAAAAATGTTGGCAGACATGG + Intronic
1164449420 19:28347613-28347635 ATCAAAAATTTTTCCAGAAAGGG + Intergenic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1166159104 19:40938380-40938402 GTTAAAAATGTAGCCAGACATGG - Intergenic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
1168591144 19:57635001-57635023 ATCTAGAAAGTCACCAGACAGGG - Intronic
926177892 2:10612833-10612855 ATAAAAAATGTGTAGAGACAAGG - Intronic
926713516 2:15903625-15903647 TTCAAAAATTTTTCGAGACAGGG - Intergenic
927145308 2:20161485-20161507 ATTAAAAATGTGGCCAGGCATGG - Intergenic
927262006 2:21101438-21101460 AATCAAAATGTCTCAAGACATGG - Intergenic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929494359 2:42427306-42427328 AATAAAAATGTTTCCTGACAGGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
929864103 2:45703380-45703402 TTGAAAAATGTAGCCAGACATGG + Intronic
931384309 2:61783699-61783721 ATAAAAAAATTATCCAGACATGG - Intergenic
933968094 2:87446908-87446930 ATTAAAAATTTAGCCAGACATGG - Intergenic
935159172 2:100514395-100514417 ATCCAAAAATTATCCAGACATGG - Intergenic
935671829 2:105562556-105562578 ATCAAAAATGTCTTCAGGCGGGG + Intergenic
936325702 2:111503596-111503618 ATTAAAAATTTAGCCAGACATGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937336301 2:121064415-121064437 ATCAAAACTGGCTCCAGACCAGG - Intergenic
937345750 2:121124378-121124400 ATCTAGAGTGTCTCCAGCCAAGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937954237 2:127410895-127410917 AACCAAAATGTCACCAGAAAAGG - Intergenic
938178387 2:129157309-129157331 ATGGAAAATGTGTACAGACATGG - Intergenic
938606650 2:132900403-132900425 AATAAAGATGTCTCTAGACATGG + Intronic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
938780123 2:134577141-134577163 ATCAAAAAAGGCTCAAAACATGG - Intronic
938792495 2:134689396-134689418 TTAAAAATTGTCTCCAGGCATGG - Intronic
938814267 2:134883647-134883669 ATCAAAAATTTAGCCAGCCATGG - Intronic
938941178 2:136170923-136170945 TTCAACAATGTCTCCAGTCCAGG + Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
941650490 2:168087260-168087282 ACCAAATATGGCTCCAGGCAGGG + Intronic
942168583 2:173266729-173266751 ATCAAAAGTTTCTCCATCCACGG - Exonic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
943673983 2:190698624-190698646 TTCAAAAAATTATCCAGACATGG - Intergenic
943695474 2:190925007-190925029 TTCAAAAATGTCTTCATAAAAGG + Intronic
943708540 2:191062208-191062230 ATAAAAAATGTATCCAGGCATGG - Intronic
946477647 2:220024082-220024104 ATCACAAGTGTCTTCAGAAAAGG - Intergenic
946629974 2:221656532-221656554 ATCAAAAATATTTCTAGAGATGG - Intergenic
946763890 2:223022259-223022281 ACCAAACATGTCTCCAGGCCGGG + Intergenic
946848566 2:223882881-223882903 ATCAAAAAATTAGCCAGACATGG - Intronic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1169012294 20:2260622-2260644 ATAAAAAAATTATCCAGACACGG + Intergenic
1169385722 20:5147692-5147714 AAAAAAAATGTGGCCAGACAGGG - Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1170798606 20:19571514-19571536 CTGAAAAATTTCTCCAGAGATGG + Intronic
1172148286 20:32772860-32772882 AAAAAAAATGTGTCCAAACAGGG - Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1172953461 20:38738021-38738043 ATAAAAAAAGTAGCCAGACATGG - Intergenic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1174091618 20:48053242-48053264 ATCAAAAAATTAGCCAGACATGG - Intergenic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174254026 20:49240857-49240879 ATCAAAAAATTAGCCAGACATGG + Intronic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1178024527 21:28451231-28451253 ATCAAAAAGTTCACCAGAAATGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179143623 21:38748905-38748927 AGCAAAAATGACTGCAGGCAAGG - Intergenic
1179371581 21:40810747-40810769 ATTAAAAAACTATCCAGACATGG + Intronic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1179727761 21:43349829-43349851 ATTAAAATTGTCTCGAGTCATGG + Intergenic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181895008 22:26099516-26099538 ATCAAAAAATTATCCAGGCATGG - Intergenic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1182125425 22:27812210-27812232 ATTAAAAATATAGCCAGACATGG + Intergenic
1182521189 22:30885311-30885333 TTCAAGAATGTGTCCAGAAAGGG + Intronic
1182570814 22:31236451-31236473 ATCAAAAATTTAGCCAGGCATGG + Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
1184461892 22:44642684-44642706 ATCCAAAAAGTAGCCAGACATGG + Intergenic
949822426 3:8130524-8130546 ATGAAAAATGAGTCCAGGCATGG + Intergenic
950510462 3:13422827-13422849 ATACAAAAAGTCGCCAGACATGG + Intergenic
950951774 3:17007978-17008000 ATAATAAAGGTCTCCATACAAGG + Intronic
951848726 3:27114318-27114340 TTCAAAAATCTCTCCAGGGATGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953000704 3:38930760-38930782 GTTAAAAATGTCTTCATACAAGG - Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955287477 3:57656800-57656822 TACAAAAATGTAGCCAGACATGG + Intronic
955506065 3:59634433-59634455 ATTTAAAATCTCTCCAGACATGG - Intergenic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956087947 3:65633248-65633270 ACCACACATGACTCCAGACACGG + Intronic
956435267 3:69229179-69229201 ATTAAAAATTTAGCCAGACATGG - Intronic
957355142 3:79073738-79073760 AGCACAAATGTGTTCAGACAAGG - Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
958485778 3:94706095-94706117 ATACAAAATTTCTCCAGGCATGG - Intergenic
958896950 3:99840004-99840026 GACAATAATATCTCCAGACATGG - Intronic
958943145 3:100336205-100336227 AACGCAAATGTCTCCAGAAAAGG - Intronic
959145525 3:102539891-102539913 ATCAAATATCTAGCCAGACATGG - Intergenic
959926927 3:111932624-111932646 AAAAAAAATGACTCCAGAAATGG - Intronic
960198481 3:114800801-114800823 AGCAAGAATCTTTCCAGACAGGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960683640 3:120274809-120274831 ATCAACAGTGCCTCCAGAAAAGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
961896362 3:130171328-130171350 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962485874 3:135841717-135841739 AGCAAACATGCCTCCAGCCAAGG + Intergenic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963711308 3:148750787-148750809 ACCAAAAGTGATTCCAGACATGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
965634880 3:170770842-170770864 ATCCCTAATGTCTCCAGACTAGG - Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
971400586 4:26272018-26272040 CTTAAAAATGTCTCCTGACTAGG + Intronic
972633600 4:40863002-40863024 TTCAAAACTGTTTCCAGAGAAGG + Intronic
972980083 4:44687282-44687304 TTCAATAATTTCTACAGACAAGG - Intronic
973061201 4:45727820-45727842 ATTAAAAATTTCACCAGCCATGG + Intergenic
973239634 4:47943841-47943863 ATGAAAAATGACTTCAGTCAGGG - Intronic
973561856 4:52144916-52144938 TTCAATATGGTCTCCAGACATGG + Intergenic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
975087621 4:70362025-70362047 ATTTAAAATGTCTCAACACATGG - Intronic
975266444 4:72374781-72374803 ATCAAAAATGACAACAGAAATGG + Intronic
975600346 4:76093269-76093291 ATAAAAAAAGTATCCAGGCATGG + Intronic
976155174 4:82136294-82136316 ATGAAAAATGCCTTTAGACATGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976456716 4:85256456-85256478 ATCACACCTGTCTTCAGACAAGG - Intergenic
976520334 4:86019342-86019364 ATCTTAAATGTCTCTAGAAAAGG + Intronic
977060188 4:92249378-92249400 ATCAAGAATGTAACCAGATAAGG + Intergenic
977376894 4:96216967-96216989 GTAAAAAATGTCTCCAAACGTGG + Intergenic
978319161 4:107475367-107475389 AACAAAAATGTCACCAAAAATGG + Intergenic
978343185 4:107738875-107738897 GGCTAGAATGTCTCCAGACAAGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
978988377 4:115045625-115045647 ATGAAAAAGGTCTCCAGGGATGG - Intronic
981735840 4:147949457-147949479 ATCAGTAATGTCTCCAAACATGG - Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984080560 4:175244342-175244364 ATCAAAAATGTCTCACAATAAGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984539121 4:181015231-181015253 ATGAAAAATCACTCCAGCCAAGG - Intergenic
985118058 4:186611504-186611526 AACAAGAATGTCCTCAGACACGG + Exonic
985245811 4:187978790-187978812 AAAAAAAATGTGGCCAGACACGG + Intergenic
985258014 4:188088756-188088778 CTAAAAAATTGCTCCAGACATGG + Intergenic
986329590 5:6707712-6707734 ATCCAAAGCGTCTCCAGACGTGG + Intergenic
986596636 5:9429607-9429629 ATCAGGAATATCTCCTGACAAGG + Intronic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987040307 5:14055953-14055975 ATGAAAAATGTCTCCAGGTGGGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987350373 5:17016723-17016745 ATCAAAAAGTTAACCAGACATGG - Intergenic
988575598 5:32420658-32420680 ATCAAAAATATATGCAGATATGG - Intronic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989226830 5:39038396-39038418 TTCAAAAATGGCACAAGACAGGG + Intronic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990189262 5:53240377-53240399 ATGAAAAATGTTTCCATACCTGG - Intergenic
990334983 5:54763843-54763865 ATCAAAAACGTCTTCTGACAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
990743597 5:58936706-58936728 ATTAAAAAAGTATCCAGGCATGG - Intergenic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
992355266 5:75975417-75975439 ATAAAATATGTCTATAGACATGG - Intergenic
992918507 5:81485799-81485821 AACACAAATGTGTCCAGGCATGG - Intronic
993032082 5:82716185-82716207 AGAAAAAATGTCTAGAGACAGGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995415029 5:111900763-111900785 ATAAAAAAAGTCTCCTAACAAGG + Intronic
995421019 5:111967006-111967028 AATAAAAATGTCTTTAGACATGG - Intronic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
995453215 5:112325618-112325640 TTCAAAAATGTCTTAAGAAAAGG + Intronic
996105389 5:119496021-119496043 ATAACCAATGACTCCAGACAGGG - Intronic
997005904 5:129815873-129815895 ATGAACACAGTCTCCAGACATGG + Intergenic
997633777 5:135389837-135389859 GTCACAAATGTCTCCTGAAAAGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
999433851 5:151546866-151546888 ATTAAAAATGTAGCCAGGCACGG - Intronic
1000221854 5:159222148-159222170 TTAAAAAATGTGTCCAAACACGG + Intergenic
1000497238 5:162000013-162000035 ATCAAAATTGTCTCCAGAAGTGG + Intergenic
1000971495 5:167719745-167719767 AACAAAAACATCACCAGACAGGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004486355 6:16069776-16069798 ATCCACAATGTTTCCAGAAATGG - Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004802017 6:19158987-19159009 ATCACAGATGACTCCAGTCATGG + Intergenic
1005187092 6:23174702-23174724 ATCAAAATTTTCTCCATACATGG + Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005392306 6:25345910-25345932 ATCAAGAATGACACCAGACTGGG - Intronic
1006705139 6:36013474-36013496 ATCAAAAATGTCTCCGGGCCAGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007493172 6:42240103-42240125 AACAAAGATGTTTCCACACAAGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1010466611 6:76174570-76174592 ATGGAAAATGACTCAAGACAAGG + Intergenic
1010508862 6:76692519-76692541 ATAAAAAATTTAGCCAGACATGG + Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013425364 6:110007822-110007844 ATTAAAAAATTATCCAGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014105450 6:117555740-117555762 ATCAAAACTGTATCAAGCCAAGG + Intronic
1015133645 6:129842421-129842443 ATCAATAATGGCACCAAACAAGG + Intronic
1016720448 6:147290051-147290073 TTTAAAAATGTATCCAGACATGG + Intronic
1017264107 6:152422656-152422678 TTCAAAAAAGTATCCAGGCATGG - Intronic
1018272563 6:162096007-162096029 GTGAAAAATGTGTCCATACAGGG + Intronic
1019813466 7:3182321-3182343 TTCAAAAATGTAGCCAGGCATGG - Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020327066 7:6982964-6982986 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1020728583 7:11849432-11849454 CTCTAAAATGTCTCTGGACACGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1021854176 7:24837497-24837519 TTCAAAAATGACTACAGGCAAGG - Intronic
1021910687 7:25383347-25383369 AAGAAAAAGGTTTCCAGACAGGG - Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022438400 7:30411877-30411899 ATCTAAAATGTCTCCTTACAGGG + Intronic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1023296518 7:38720730-38720752 ATTAAAAATGACTCCAGGCCTGG - Intergenic
1023583721 7:41707343-41707365 AACCAAAATGTCTTCAAACATGG - Intergenic
1024315635 7:48014119-48014141 ATCAAAAAATTAGCCAGACATGG - Intronic
1024432849 7:49310336-49310358 ATGAACAATGTCTACAGAAAAGG - Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1026031984 7:66802187-66802209 TTTAAAAATGTCTCCAGGCCTGG - Intronic
1026389063 7:69881309-69881331 ATCAAAAATCTTCCCACACAAGG - Intronic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027761714 7:82287092-82287114 ATCATATATGTCTCCAACCAAGG + Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028117392 7:87015495-87015517 ATGAAAAATCTGGCCAGACATGG + Intronic
1028209604 7:88057248-88057270 TTCAAAAATGTGGCCAGGCATGG - Intronic
1029335137 7:99892423-99892445 TTCAAAAATGTCCCCAGATGTGG - Exonic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1030629750 7:111882897-111882919 ATTAAAAATGTAGCCAGGCATGG - Intronic
1030855654 7:114553039-114553061 ATCTAAAATGCTTCCACACATGG - Intronic
1031261863 7:119531800-119531822 CTCAAAAATGACTCCTGCCATGG - Intergenic
1031426084 7:121607428-121607450 ATAAAAAATTTAGCCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1033430768 7:141287690-141287712 TTTGAAAATGTCCCCAGACATGG + Intronic
1033822306 7:145149098-145149120 ATCTAAAATGACTCTAGAGAAGG - Intergenic
1034935234 7:155194969-155194991 ATCCAAACTGTCCCCAGACATGG - Intergenic
1035691780 8:1563948-1563970 ATTTAAAAGGTCTTCAGACAGGG - Intronic
1035890836 8:3340993-3341015 ATCAAAAATGTCTGTAGAATTGG + Intronic
1036117219 8:5971521-5971543 AAAAAAAAAGTATCCAGACATGG + Intergenic
1036369564 8:8151123-8151145 CTCAAAGTTGTCTCCAGACCAGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1036881324 8:12514521-12514543 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1037650779 8:20836574-20836596 ATCGTAAAACTCTCCAGACATGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1037779401 8:21857432-21857454 TTCAAAAAAGTGTCCAGGCATGG + Intergenic
1037881560 8:22575785-22575807 ATCAAAACAGTCTGCAAACAAGG - Exonic
1038323251 8:26548721-26548743 AAAAAAAAAGTCACCAGACATGG + Intronic
1039208583 8:35185176-35185198 AACTAAAATGTCTTCAGTCAAGG + Intergenic
1039534922 8:38301123-38301145 ATCAAAAACGTAGCCAGGCATGG - Intronic
1039942395 8:42102372-42102394 ATAAGAAATGTCTCCAGGCCAGG + Intergenic
1040412489 8:47168510-47168532 AGCAAGAATGTCTCCATCCAAGG - Intergenic
1041811851 8:61920314-61920336 ATGAAAAAAGTCCCCAAACAAGG - Intergenic
1042351429 8:67781383-67781405 ATTAAAAATGTAGCCAGGCATGG - Intergenic
1042569681 8:70149394-70149416 ATCAAAAAATTAGCCAGACATGG - Intronic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1043875613 8:85482931-85482953 ATTGAAAAAGTCTCCAGAAAAGG + Intergenic
1044458307 8:92414840-92414862 ATCAAAGATGTTTCCAGGAAGGG - Intergenic
1044572053 8:93731003-93731025 ATAAAAAATTTAGCCAGACAAGG + Exonic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1045807891 8:106186746-106186768 ATGAAAAACATCTCCAGGCAAGG - Intergenic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1046784381 8:118250647-118250669 ATAAAAAATTTAGCCAGACATGG - Intronic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1049533087 8:143166151-143166173 ATCAAAGACGTCTGCAGAAATGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051002335 9:12298767-12298789 GTCAAAAATTTATCCAGGCACGG - Intergenic
1053251586 9:36578636-36578658 ATAAACAATGTTTCCATACAAGG - Intronic
1054849854 9:69836433-69836455 CGCAACAATGTCTCCAGGCATGG + Intronic
1054850194 9:69839714-69839736 AACCAAAATTTGTCCAGACATGG - Intronic
1055216309 9:73867154-73867176 ATCAAAAATATCTCCAATGATGG - Intergenic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055461932 9:76527824-76527846 AGCAAAAATGTGTCCAGAATTGG + Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056417018 9:86386593-86386615 ATCAAATATGTCTCCAGATCTGG + Intergenic
1057464427 9:95299703-95299725 ATCAAAAAATTAGCCAGACATGG + Intronic
1057547803 9:96031222-96031244 AACAGAAATATTTCCAGACAGGG + Intergenic
1057636749 9:96776477-96776499 ATCAGAAACGTCTCCAGGCCGGG + Intronic
1058206529 9:102115806-102115828 ATCAAATATGTCACAAAACAAGG + Intergenic
1058542106 9:106022249-106022271 ATTAAAAATCTCTCCTGACTTGG + Intergenic
1059604779 9:115822743-115822765 ATCAATAGTGTCTCCAGATAAGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061038495 9:128126550-128126572 ATCAAAAAAGTCTTAAAACACGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1062116098 9:134809809-134809831 GTCAGAAATGTCCCCAGAGAGGG - Intronic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185822862 X:3221395-3221417 ATAAAAAATGTAGCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186682969 X:11895280-11895302 AACAAAGATGTTTCCAGGCATGG + Intergenic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1188269853 X:28125581-28125603 TTTAAAAATGTGTCCATACAGGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1190782959 X:53616066-53616088 AAAAAAAATTTCTCCAGTCACGG - Intronic
1191820030 X:65295923-65295945 AGCAAAAATATATCCAGAAAGGG + Intergenic
1194040221 X:88931959-88931981 ATCAAAAATATCACCATATATGG - Intergenic
1194613397 X:96071921-96071943 ATCAAAATTATCTCCAGAAAGGG - Intergenic
1194775197 X:97954576-97954598 ATCAGTAATGTCTCTAGCCATGG + Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195709842 X:107765065-107765087 ATCAAAAGTGTCCCCACACCAGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196124800 X:112085656-112085678 ACCAAAAATGCGTCCAGGCATGG + Intergenic
1198082290 X:133251445-133251467 ATCACAAGTGTCTCCACGCAAGG + Intergenic
1198715112 X:139550201-139550223 ATCAACAATGGCTACAGAAAAGG - Intronic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1199749778 X:150804454-150804476 AACAAAGATCTCTCCAGGCACGG + Intronic
1200384119 X:155872051-155872073 ATGAAAGCTGTCACCAGACAGGG - Intergenic
1200904241 Y:8465050-8465072 ATCCAAAATGTCTCAACACCTGG - Intergenic
1200978272 Y:9236851-9236873 CTCAAAAATGTATACAGAAATGG + Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic
1202262634 Y:22985608-22985630 AACAAAAATGTCTCAACACTGGG - Intronic
1202415624 Y:24619349-24619371 AACAAAAATGTCTCAACACTGGG - Intronic
1202455163 Y:25050737-25050759 AACAAAAATGTCTCAACACTGGG + Intronic