ID: 1060820634

View in Genome Browser
Species Human (GRCh38)
Location 9:126659488-126659510
Sequence GCCCCTGGCCTGAGAATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 253}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060820634_1060820641 28 Left 1060820634 9:126659488-126659510 CCACACATTCTCAGGCCAGGGGC 0: 1
1: 0
2: 2
3: 30
4: 253
Right 1060820641 9:126659539-126659561 CTTCAGAGGTGGTCCTGTGTGGG No data
1060820634_1060820640 27 Left 1060820634 9:126659488-126659510 CCACACATTCTCAGGCCAGGGGC 0: 1
1: 0
2: 2
3: 30
4: 253
Right 1060820640 9:126659538-126659560 GCTTCAGAGGTGGTCCTGTGTGG No data
1060820634_1060820638 14 Left 1060820634 9:126659488-126659510 CCACACATTCTCAGGCCAGGGGC 0: 1
1: 0
2: 2
3: 30
4: 253
Right 1060820638 9:126659525-126659547 TGATGCTGGCTTAGCTTCAGAGG No data
1060820634_1060820639 17 Left 1060820634 9:126659488-126659510 CCACACATTCTCAGGCCAGGGGC 0: 1
1: 0
2: 2
3: 30
4: 253
Right 1060820639 9:126659528-126659550 TGCTGGCTTAGCTTCAGAGGTGG No data
1060820634_1060820643 30 Left 1060820634 9:126659488-126659510 CCACACATTCTCAGGCCAGGGGC 0: 1
1: 0
2: 2
3: 30
4: 253
Right 1060820643 9:126659541-126659563 TCAGAGGTGGTCCTGTGTGGGGG No data
1060820634_1060820637 0 Left 1060820634 9:126659488-126659510 CCACACATTCTCAGGCCAGGGGC 0: 1
1: 0
2: 2
3: 30
4: 253
Right 1060820637 9:126659511-126659533 TCTGCTGGCTCTGATGATGCTGG No data
1060820634_1060820642 29 Left 1060820634 9:126659488-126659510 CCACACATTCTCAGGCCAGGGGC 0: 1
1: 0
2: 2
3: 30
4: 253
Right 1060820642 9:126659540-126659562 TTCAGAGGTGGTCCTGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060820634 Original CRISPR GCCCCTGGCCTGAGAATGTG TGG (reversed) Intronic
900437011 1:2635561-2635583 TAGCCTGGCCTGAGAGTGTGGGG - Intergenic
901149621 1:7092545-7092567 ACCTCTGGCCTGAGAATGGGAGG + Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902613451 1:17610367-17610389 GCCCCCAGCCTGAGAGTGTGAGG - Intronic
904282081 1:29427643-29427665 GTCCCTGGGGTGGGAATGTGTGG - Intergenic
904597247 1:31654656-31654678 ACCCCAGGCCTGTGAGTGTGTGG + Intronic
904674127 1:32187834-32187856 GCTCCTGGCCTGAGAGGGTAAGG + Intronic
904746475 1:32714391-32714413 GGCCCTGCCCTGTGAATGTTTGG + Intergenic
905066982 1:35192501-35192523 GCCTCCGGCCTGAGGAGGTGTGG + Exonic
906069680 1:43007696-43007718 GCCCCAGGCCCGGGAATGTGGGG - Intergenic
907707867 1:56848153-56848175 GCCCCTGCCCTAGGAATGTGTGG - Intergenic
908441394 1:64158431-64158453 GCCACTGGCCTGAGAATATGGGG - Intronic
908772456 1:67609386-67609408 CCCCCTGGCCTGTGCAAGTGAGG + Intergenic
908829868 1:68168188-68168210 GTCCCTGGGGTGGGAATGTGGGG + Intronic
909051127 1:70769602-70769624 GCTTTTGGCCTGAGACTGTGGGG + Intergenic
909373554 1:74914570-74914592 GCCCCTGCCCTAAGGATCTGTGG - Intergenic
910624178 1:89288947-89288969 CACCCAGGCCTGAGAAGGTGGGG - Intergenic
914220204 1:145674614-145674636 GCATTTGGCCTGAGAATCTGGGG - Intronic
914472782 1:147997476-147997498 GCATTTGGCCTGAGAATCTGGGG - Intergenic
915194887 1:154182357-154182379 GCCCCTGGCCAGAGGATGAGAGG + Intronic
915735347 1:158081031-158081053 GCCCCTGGCCTGGGGAGCTGGGG - Intronic
916735965 1:167607346-167607368 GCCCCTGCCCTAAGTATCTGTGG + Intergenic
917028749 1:170667426-170667448 TCCGCTGGCATGAGAATGGGAGG + Intronic
919052912 1:192533448-192533470 GGCCCTGTGCTGAGAATGTTTGG - Intergenic
919388791 1:196955179-196955201 GCCCCTGCCCTGAAGATGTGTGG - Intronic
919861682 1:201742872-201742894 GCCCCTGCCCTGAGCTTGGGAGG + Intronic
920007366 1:202843264-202843286 GCCCCTGGCGTGAGCAGGGGAGG + Intergenic
1063589639 10:7383733-7383755 GGCCCTGTGCTGAGAAAGTGAGG - Intronic
1065624138 10:27613501-27613523 GAGCCTGGCCTGAGAAAGGGAGG - Intergenic
1067946796 10:50694678-50694700 GTCCCTGGTCCCAGAATGTGAGG - Intergenic
1070145057 10:73767869-73767891 GACCCTGGCCAAAGAGTGTGTGG + Exonic
1070747887 10:78945819-78945841 CCCCTTGGCTTGAGAAAGTGTGG - Intergenic
1073214938 10:101830918-101830940 GCCCCAGGCCTGCGTGTGTGGGG - Intronic
1074141137 10:110673730-110673752 GCCACTGTCCTCAGAATGTGGGG - Intronic
1077102429 11:828103-828125 GCCCCTGGCCTGGGCCTGTGTGG - Intronic
1077374172 11:2197807-2197829 GCGCCAGGCCTGAGGACGTGGGG + Intergenic
1079539959 11:21561298-21561320 GCCCCAGGTCTGTGGATGTGTGG - Intronic
1081731327 11:45373788-45373810 CCCTCTGGCCTGTGACTGTGAGG + Intergenic
1082287869 11:50336089-50336111 GCCCCTGCCCTAAGGATCTGTGG - Intergenic
1083766091 11:64842289-64842311 GGCCCTGGCCTGAACCTGTGAGG - Intronic
1085655483 11:78310576-78310598 GGCCCAGGCCCAAGAATGTGTGG + Intronic
1086564785 11:88212873-88212895 GCCCCTGCCCTAAGGATCTGTGG - Intergenic
1087877429 11:103374980-103375002 GCCCCTGGCCTGTGAAGGGAGGG - Intronic
1089683550 11:120132884-120132906 TCCCCTGACCTGAGGCTGTGAGG - Intronic
1089777807 11:120850982-120851004 GCCACTGGGCTATGAATGTGAGG - Intronic
1090707345 11:129350672-129350694 GCCAAAGGCCTGAGAATCTGGGG - Intergenic
1091173620 11:133540521-133540543 GACCCAGGCCTGGGAATGAGAGG - Intergenic
1091195468 11:133727164-133727186 GGCCCTGTGCTGAGGATGTGTGG - Intergenic
1093351087 12:18103828-18103850 GCCCCTGTCCTGGAAATCTGTGG - Intronic
1094063189 12:26336225-26336247 TCCCCAGGACTGAGAATGAGTGG - Intergenic
1094844175 12:34354230-34354252 TCCCCTGGCCCCAGCATGTGTGG + Intergenic
1095850682 12:46800502-46800524 GGACCTGGGCTAAGAATGTGGGG - Intronic
1096252374 12:50041359-50041381 GCCCCAGGCCTGACAGAGTGAGG + Intergenic
1096676978 12:53231387-53231409 GCACCTGGGCTGGGAACGTGTGG + Intronic
1096909081 12:54963815-54963837 GCCCTTGGCCTGAGAGGGGGTGG + Exonic
1101718667 12:107332647-107332669 GCAGCTGTCCTGAGACTGTGTGG + Intronic
1103932115 12:124456390-124456412 GTCCCTGGGCTGAGGATGGGTGG - Intronic
1105581812 13:21705135-21705157 GACCCTGGCCACAGAATGTTTGG + Intergenic
1106136402 13:26976852-26976874 GGACCTGGCGTGGGAATGTGTGG - Intergenic
1108725957 13:53181671-53181693 CCCCATGGCTTAAGAATGTGTGG - Intergenic
1110793716 13:79613177-79613199 GCCCCTGCCCTAGAAATGTGTGG - Intergenic
1111608732 13:90576266-90576288 GCCCCTTGCCTCATCATGTGGGG - Intergenic
1113676587 13:112211494-112211516 CCTGCTGGCCTGAGAATGAGTGG + Intergenic
1115823422 14:37236969-37236991 GCCTCTTGCCTGGGCATGTGCGG + Intronic
1115893884 14:38062116-38062138 GCCCCTGCCCTCAGGATTTGTGG - Intergenic
1116079794 14:40157161-40157183 GCCCCTGCCCTGAAGATTTGGGG - Intergenic
1117881762 14:60319568-60319590 GCCCCTGGCCTAAGGATCTGTGG + Intergenic
1118024112 14:61751328-61751350 GCTCCTGGCCTGCGAACGGGCGG + Intergenic
1118689749 14:68326828-68326850 GCCCCTAGATTGAGAAGGTGAGG + Intronic
1119644671 14:76339727-76339749 GCCCCGGGCTTGTGAGTGTGGGG - Intronic
1120406986 14:84102783-84102805 GCCCCTGCCCTTGGAATCTGTGG + Intergenic
1120693858 14:87622196-87622218 GCCCCTGGCCTGGGGATCTGTGG - Intergenic
1121957356 14:98226514-98226536 TCCCCTGGCCTGGGATTGAGTGG + Intergenic
1122688102 14:103519419-103519441 GCTCCAGGCCTGAGCATCTGAGG - Intergenic
1122806866 14:104264256-104264278 GCCCCTGACTTTAGTATGTGAGG + Intergenic
1122902275 14:104786847-104786869 GCCCCTGGCCCCAGTCTGTGGGG + Intronic
1122986488 14:105214018-105214040 GCCAGGGGCCTGAGGATGTGGGG + Intronic
1122997339 14:105272356-105272378 CCCTCTGGCCTGAGCAGGTGGGG - Intronic
1124182243 15:27487509-27487531 GCCACTGGCCTCAGAATGAGAGG - Intronic
1124641153 15:31397385-31397407 GCCCCAGGCCTGAGAATGGTCGG - Intronic
1126543276 15:49844931-49844953 GTCCTTGGCCTGTGAGTGTGTGG - Intergenic
1126984075 15:54282618-54282640 GCCCCTTGCCTCATCATGTGGGG + Intronic
1128282931 15:66411836-66411858 GCACCTGGACAGAGAATGGGTGG - Intronic
1128323169 15:66706478-66706500 GCCCCTGGCCTGAGAGCTGGGGG + Intronic
1129513154 15:76139734-76139756 GCCCCCGGCCTGAGCCTGTTAGG + Intronic
1130313005 15:82771337-82771359 GCACCTGTCCTGGGCATGTGGGG - Intronic
1130424411 15:83780711-83780733 GCCTTTGGCCTGAGACTATGGGG - Intronic
1132613359 16:828618-828640 GCCCCTGACCTGGGAGTCTGGGG + Intergenic
1133414630 16:5596734-5596756 TCCACTGGTCTGAGAATGTCTGG - Intergenic
1134474805 16:14563981-14564003 CCCCCTGTACTGAGAATGGGAGG + Intronic
1136669066 16:31839609-31839631 GCCTGGAGCCTGAGAATGTGAGG - Intergenic
1138753057 16:59447503-59447525 GCTTCTGGGCTGAGAATGTGGGG + Intergenic
1140203497 16:72913883-72913905 GCACCTGGCCTGGCACTGTGAGG - Intronic
1141033630 16:80610316-80610338 GCCACAGTCCTGAGAATGTGCGG + Intronic
1142003485 16:87677853-87677875 GCCGGAGGCCTGAGATTGTGGGG + Intronic
1142082437 16:88157298-88157320 GCCCCACGCCTGAGGCTGTGGGG - Intergenic
1142406808 16:89894535-89894557 GCCCCTGGCCTGGGCATGTCAGG + Intronic
1142941161 17:3380780-3380802 CCCCCAGGCCTGAGAGCGTGGGG + Intergenic
1143026806 17:3945793-3945815 GCCATTTGCTTGAGAATGTGCGG - Intronic
1143389813 17:6553671-6553693 GCACCCGGCCTGTGAATGAGGGG - Intronic
1143389963 17:6554604-6554626 GTCCCTGGGCTGAGAGTCTGTGG - Intronic
1145208006 17:20994887-20994909 TCCCCTGGGCTGAGGCTGTGTGG + Intergenic
1145816456 17:27798410-27798432 GAGCTTGGCCTGAGAATGGGAGG - Intronic
1146522729 17:33538791-33538813 GCCCATGGCATGAGGCTGTGAGG + Intronic
1148225656 17:45896417-45896439 TCGCCTGGCCGGAGAATGTGAGG + Intronic
1148563959 17:48622236-48622258 GCCCTTGGCCTGAGAATAGTTGG + Exonic
1151427643 17:74041461-74041483 TCCCCTGGGGTGAGAATGGGAGG - Intergenic
1152146938 17:78574059-78574081 GCCCATGGCCTGGGAAGGTGGGG - Intronic
1152366159 17:79857772-79857794 GACCTGGCCCTGAGAATGTGGGG + Intergenic
1152541555 17:80979313-80979335 TCTCCTGGCCTGGGAGTGTGTGG - Intergenic
1154091276 18:11365688-11365710 GCGCCTGCCCTCAGAATGTTTGG - Intergenic
1155017833 18:21863268-21863290 GCCCCTTGCCTCATAGTGTGGGG + Intronic
1157295252 18:46437640-46437662 AACCCTGGCCTGAGAGTGTGTGG + Intronic
1158447788 18:57536258-57536280 GCCCCTGTCCAGAGCACGTGTGG - Intergenic
1160375102 18:78405766-78405788 AACCCTGGCCTGAGAACGGGAGG - Intergenic
1160395245 18:78566159-78566181 GACCCTGGCCTGAGAATGAATGG + Intergenic
1161060920 19:2214395-2214417 AACCCTGCCCTGAGAGTGTGGGG + Intronic
1161179962 19:2873606-2873628 GCACCTGGCCTCAGTAGGTGAGG + Exonic
1161221041 19:3118351-3118373 GTGCGTGGCCTGAGAGTGTGAGG + Intronic
1161346284 19:3770351-3770373 GCACCTGGCCTGAGAATACTTGG + Exonic
1161622977 19:5309037-5309059 GGCCCTGGGCTCAGAGTGTGTGG + Intronic
1162136515 19:8558734-8558756 GCTCCTGGCCTGGGGATGGGGGG - Intronic
1162433469 19:10643087-10643109 GTTCCTGGCCTGCGAGTGTGGGG + Intronic
1163758746 19:19121580-19121602 GCCGCAGGCCTGGGAAGGTGAGG + Exonic
1165075283 19:33276882-33276904 GCCCCTGGTCTGAGAGCTTGAGG - Intergenic
1165779915 19:38426233-38426255 CCCCCTGGCCTGAGGGTGGGTGG - Exonic
1165926495 19:39329316-39329338 GCCCCAGGACTGAGAACGGGTGG + Intronic
1167769331 19:51504543-51504565 GCCCCTGCCCTAGGAATCTGTGG + Intergenic
925291867 2:2753288-2753310 GCCCCTGCCCTAAAAATCTGTGG + Intergenic
925588284 2:5484976-5484998 ACCCCTGGCATGGGAGTGTGTGG + Intergenic
926693589 2:15754596-15754618 TCCCATGGCCTGAGAGTGGGTGG + Intergenic
928363764 2:30686205-30686227 ACTCCTGGGCTGAGATTGTGTGG + Intergenic
930091424 2:47534098-47534120 GTCACTGGCCTGAGCCTGTGGGG - Intronic
932247092 2:70205013-70205035 GCGCCTGGCTTGAGAATCTAAGG + Intronic
936827493 2:116600086-116600108 AGCCATGGCCTGAGAAAGTGTGG - Intergenic
937908697 2:127065001-127065023 AGCCCCGGCCTGAGAACGTGAGG - Intronic
937935163 2:127238223-127238245 GCCCCTGGCCTGGAGATCTGTGG + Intergenic
938059101 2:128238406-128238428 GCCCCTTGCCTGGGAGAGTGAGG - Intronic
943433231 2:187830252-187830274 GCCCATTGCCTGAGGATGTTTGG + Intergenic
946726634 2:222667685-222667707 GAACCTTGCCTGAGAAGGTGAGG - Intergenic
946902307 2:224384227-224384249 GCCCATGGCCTCAGAATGCCTGG - Intronic
947491222 2:230596024-230596046 GCCTGTGGCCTAAGAATGTAAGG - Intergenic
947673974 2:231961221-231961243 GTCCCTGCCCTCAGGATGTGAGG - Intergenic
947853570 2:233307859-233307881 GCTCCTGGCCTACGTATGTGGGG - Exonic
948631037 2:239302929-239302951 GCTCCGGGCCTGAGCCTGTGTGG - Intronic
1168913970 20:1471596-1471618 GTCATTGGCCTGAGAAAGTGGGG - Intronic
1170122017 20:12922249-12922271 GCCCCTGCCCTGGGGATCTGTGG + Intergenic
1172696323 20:36825608-36825630 GCCCCTGGCCTGAGCTGATGTGG - Intronic
1173264508 20:41466995-41467017 TCCACTGGCCTCAGTATGTGTGG - Intronic
1173981573 20:47228183-47228205 TCCCCTGTCATGAGAATGTCTGG + Intronic
1174036382 20:47671009-47671031 GCCTGTGCCCTGAAAATGTGTGG - Intronic
1175583836 20:60121719-60121741 GCCCCCGTCCTGATACTGTGAGG + Intergenic
1175921756 20:62453480-62453502 AGCCCTGGCCTGGGCATGTGAGG + Intergenic
1176017534 20:62943445-62943467 GTCCCTGGCCTGGGTGTGTGGGG + Intronic
1177206334 21:18015802-18015824 GCCCCTGGTCTAAGTATCTGTGG + Intronic
1177585186 21:23083521-23083543 GCTCCTGACCTGAGAATATGAGG - Intergenic
1178430275 21:32512645-32512667 GTCCCTGGCCTGACCATGGGTGG + Intronic
1178709949 21:34907986-34908008 CCCCCTGACCTGTGAATTTGTGG + Intronic
1179884116 21:44306203-44306225 CCCCGTGGCCTGTGAGTGTGGGG + Intronic
1179982088 21:44900889-44900911 GCCCCTGGCAGGCGCATGTGGGG + Intronic
1180187023 21:46145172-46145194 TGCCATGGCCTGTGAATGTGGGG + Intronic
1180188086 21:46150298-46150320 GGCCCTGGCTGGAGGATGTGGGG + Intronic
1180963859 22:19775728-19775750 GCTCCTGGCCTCAGAATATTCGG - Intronic
1182446599 22:30393259-30393281 TGCCCTGGCCTCAGAATCTGTGG - Intronic
1183352782 22:37343309-37343331 GCCCCTGGGCTCCGAATGGGTGG + Intergenic
1183353491 22:37346299-37346321 GGCCCTGGCCGGAGCAGGTGGGG + Intergenic
1184658799 22:45955843-45955865 GCCTCTGGCCTGAGACTGCAGGG - Intronic
950419703 3:12891603-12891625 GCCACAGGCCTGAGAACCTGGGG + Intergenic
951179441 3:19641852-19641874 GCTCCTGGCCACAGAGTGTGGGG - Intergenic
953283712 3:41583654-41583676 GGCCATGGCCTGAGGAGGTGAGG - Intronic
953793151 3:45963758-45963780 GCCCCAAGCCTGAAAATGAGGGG + Intronic
954376499 3:50196629-50196651 GTACCTGGCCTGACAAGGTGGGG + Intergenic
954412128 3:50375361-50375383 TCCTCTGCCCTGAGACTGTGAGG + Intronic
954868689 3:53750733-53750755 GTCCCTGGAGTGAGCATGTGAGG + Intronic
959046012 3:101474571-101474593 GCCTTTGGGCTGAGAATATGGGG + Intronic
960445005 3:117737273-117737295 GCCCCTTTCCTGAGAACATGTGG + Intergenic
960519928 3:118643024-118643046 GCCCCTGGCCAGCGAACATGTGG + Intergenic
961119802 3:124364274-124364296 GCTCTTGGCCTGTGAATGTCAGG + Intronic
961790392 3:129371699-129371721 GCCCCTGTCCTGGGAAGTTGAGG + Intergenic
961839611 3:129697733-129697755 GCCCCTGCCCTAAGGATCTGTGG - Intronic
963523105 3:146380823-146380845 GCCCCTTGCCTCATCATGTGGGG + Intergenic
963909975 3:150808502-150808524 GCCCCTGGACCTAGGATGTGGGG + Intergenic
966249786 3:177851538-177851560 GCACCTGGCCTTGGAATGAGTGG + Intergenic
966919947 3:184604602-184604624 GGCCCTGGGCGGAGAGTGTGGGG + Intronic
968997421 4:3954771-3954793 GCGCCTGTGCTGAGAATGGGAGG + Intergenic
969456619 4:7303864-7303886 GGACCTGTCCTGAGAGTGTGGGG + Intronic
969719470 4:8885340-8885362 GCCCCAGGCCTGAGAAGGAGTGG + Intergenic
971648615 4:29241483-29241505 GGCCCTGGCCTGAAGATATGAGG + Intergenic
971753243 4:30677821-30677843 GCCCCTGCCCTAGGAATTTGTGG + Intergenic
972227950 4:37035988-37036010 ACCCCTGGCCTAGGGATGTGGGG - Intergenic
973561224 4:52138240-52138262 GCCACTGGCTTGAGACTGTGAGG + Intergenic
974431267 4:61799492-61799514 GGCCATGGCCTGAGTATGTGTGG - Intronic
975132351 4:70842071-70842093 GCCTCTAGCCAGAGGATGTGGGG - Intergenic
976222531 4:82769204-82769226 GCCACTGCCCTGAGATTGTGAGG + Intronic
977093981 4:92715164-92715186 GCCCCTGTCCTAGAAATGTGTGG - Intronic
977176906 4:93829279-93829301 GCCCCGGGCCGGTGAAAGTGCGG + Exonic
977441259 4:97070660-97070682 GCAAGGGGCCTGAGAATGTGTGG + Intergenic
977772793 4:100879777-100879799 GCCTCTGGCTTTAGAAAGTGAGG - Intronic
978213230 4:106163101-106163123 GCCCCTGCCCTGGAAATATGTGG - Intronic
978990690 4:115078513-115078535 GCCCCTGCCCTGTGGATCTGTGG + Intronic
981933914 4:150218695-150218717 GCCTGTGGCCTGACCATGTGGGG + Intronic
982075931 4:151737321-151737343 GCCCCTGCCCTGGAGATGTGTGG + Intronic
983482259 4:168289726-168289748 ACCCCTGGCTTGAGCATTTGTGG - Intronic
983846618 4:172528245-172528267 GTTGCTGGCATGAGAATGTGGGG + Intronic
984012342 4:174385405-174385427 GCCTCTGGCCTGAGAAAGAATGG - Intergenic
984065503 4:175043307-175043329 GCCCCTGCCCTAAGGATCTGTGG + Intergenic
987477465 5:18408996-18409018 GGTCCTGCCCTCAGAATGTGTGG + Intergenic
990166915 5:53004523-53004545 GCCCCAGGCCTGACACTCTGTGG - Intronic
991595276 5:68298010-68298032 AACCCTGGCCTGAGAAGGTTTGG + Exonic
993597910 5:89882401-89882423 TCCTCTGCCCTGAAAATGTGGGG - Intergenic
995563047 5:113403754-113403776 GACCCAGGGGTGAGAATGTGAGG + Intronic
997274701 5:132574788-132574810 GCCCCTGCCCTAGGAATGTGTGG - Intronic
997594832 5:135100125-135100147 GACCCTGGTTTGAGGATGTGAGG - Intronic
998158943 5:139802238-139802260 GGGCCTGGACAGAGAATGTGAGG + Intronic
998160550 5:139810613-139810635 GCCCCTGGCCTGGGCATTTGTGG + Intronic
998284571 5:140846794-140846816 GCCCCTGGCTTTAAAATTTGAGG + Intronic
999144279 5:149382146-149382168 GGCCCGGGACTGAGAATGAGGGG + Intronic
999515932 5:152301402-152301424 GACCATGGCCTGAGAGGGTGTGG + Intergenic
1000107202 5:158071324-158071346 GCTCATGGACTGAGAATGGGAGG + Intergenic
1000415259 5:160977484-160977506 TACCTTGGCCTGAGAATATGGGG + Intergenic
1001415559 5:171542844-171542866 GCCCCTGGCCTGGGAAGGGCTGG + Intergenic
1002702765 5:181137764-181137786 TCCACAGGCCTGAGAGTGTGTGG - Intergenic
1003276920 6:4661208-4661230 CTCCCTGGCCAGAGAATGGGAGG - Intergenic
1005892424 6:30150858-30150880 ACCCCTGGCCTGATCATCTGTGG - Intergenic
1005908267 6:30284590-30284612 GCCCCTGCCCTAGGAATCTGTGG - Intergenic
1006215939 6:32442820-32442842 ACCTCTGGCATGAGAATTTGGGG - Intronic
1009945994 6:70342140-70342162 GCCCCTGCCCTAAGGATCTGTGG - Intergenic
1016834558 6:148464468-148464490 GCCCCAGGCCTGAGGATGGTGGG - Intronic
1017969583 6:159299871-159299893 GGACCTGGCCTGAGACTGGGTGG - Intergenic
1019451917 7:1103277-1103299 TCCCCTGGGCTGAGATTGTCGGG + Intronic
1019690628 7:2409185-2409207 GCACCTGGGCAGAGAAGGTGTGG + Intronic
1020573502 7:9896292-9896314 GCCCCTGCCCTAGGAATCTGTGG + Intergenic
1022286668 7:28960294-28960316 GCACCTGGCCTGAGAGTGTGAGG + Intergenic
1022400104 7:30028591-30028613 GCCCCCGGGCCGAGGATGTGAGG + Exonic
1023011007 7:35924892-35924914 GCGCCTGGCCAGAGAAGGGGAGG - Intergenic
1024006598 7:45228914-45228936 CCCCATAGCCTCAGAATGTGGGG + Intergenic
1024080120 7:45848951-45848973 GCGCCTGGCCAGAGAAGGGGAGG + Intergenic
1024183825 7:46927264-46927286 GCCCCTGCCCTGAAAGTATGTGG - Intergenic
1028709606 7:93891696-93891718 GCCCCTGGCCTAAGGATGGAAGG - Intronic
1029122686 7:98279325-98279347 GCCCCTGGCCAGAGAATACTGGG - Intronic
1030068482 7:105678750-105678772 GCCTCCGGCCTGAGAAGGAGTGG - Intronic
1030804270 7:113895066-113895088 GCCACTCACCTGAGCATGTGTGG + Intronic
1031183531 7:118446822-118446844 GCCAATGGCCTGAGAAACTGAGG + Intergenic
1031769841 7:125829653-125829675 GCCCCTGCCCTAGGAATCTGTGG - Intergenic
1033760646 7:144433168-144433190 GTCCCTGGGCTGAGGAGGTGGGG - Intergenic
1034433689 7:151053241-151053263 GCCCCAGGCTTGAGACGGTGGGG + Intergenic
1034896169 7:154877835-154877857 GCCCCTGAGCAGAGGATGTGGGG + Intronic
1035635907 8:1144079-1144101 TCCCCTGTGCTCAGAATGTGAGG + Intergenic
1035970058 8:4238120-4238142 GCCCCTGGCCTAAAAATGTCTGG + Intronic
1041469260 8:58190759-58190781 GCCACAGGCCTGAGAACTTGGGG - Intronic
1042323601 8:67504655-67504677 GCCCTGGGCATGAGGATGTGTGG - Intronic
1044830384 8:96241780-96241802 GCCCCTAGCCTGAGAATTATTGG + Intronic
1046481317 8:114822038-114822060 GCCCCTGCCCTAGGAATCTGTGG - Intergenic
1046895522 8:119467758-119467780 GCTTCTGGGCTGAGAATATGGGG - Intergenic
1047530372 8:125668715-125668737 GCCCATAGCCTGAGGATGTCTGG + Intergenic
1049027924 8:140009526-140009548 GCCTTTGTCCTGAGAATCTGTGG - Intronic
1049404786 8:142447535-142447557 GCCCCAGCCCTGAGAACCTGGGG + Intergenic
1049423795 8:142528377-142528399 GCCCCAGGCCTGAGTTCGTGAGG + Intronic
1049644976 8:143732121-143732143 GCCACTTGGCTGAGAATGTTGGG + Intronic
1050909877 9:11055321-11055343 GCCCCTGTCCTAAAAATGTGTGG + Intergenic
1050979918 9:11997024-11997046 GCACCTGGCCTCAGAGTCTGAGG + Intergenic
1050996938 9:12232405-12232427 GCCCCTGGCCTAGAAATCTGTGG - Intergenic
1052702270 9:31951292-31951314 GCCCCTGCCCTGGGGATCTGTGG - Intergenic
1053574432 9:39344585-39344607 GCCCCTGCCCTGGAGATGTGTGG + Intergenic
1053838996 9:42172833-42172855 GCCCCTGCCCTGGAGATGTGTGG + Intergenic
1054117459 9:61179214-61179236 GCCCCTGCCCTGGAGATGTGTGG + Intergenic
1054590296 9:67003352-67003374 GCCCCTGCCCTGGAGATGTGTGG - Intergenic
1055135462 9:72824305-72824327 GCCCCTTGCCTCATCATGTGGGG + Intronic
1055363895 9:75524292-75524314 GCCCCTGCCCTAGGAATTTGTGG + Intergenic
1055708429 9:79033472-79033494 GCCCCTTGCCTCATAGTGTGGGG + Intergenic
1056949890 9:91033593-91033615 ACCCTTGGCCTGAGTGTGTGTGG + Intergenic
1059324848 9:113497890-113497912 ACTCCTGGCCTCAGGATGTGGGG - Intronic
1060213231 9:121723204-121723226 GCCCACGGCCTGAGTCTGTGTGG - Intronic
1060820634 9:126659488-126659510 GCCCCTGGCCTGAGAATGTGTGG - Intronic
1061411556 9:130424822-130424844 GGCCCTGGCCAGAGAGAGTGGGG + Exonic
1061885211 9:133587847-133587869 GACCCCAGCCTGAGAAAGTGGGG - Intergenic
1062707749 9:137954579-137954601 GGCCATGCCCTGAGAATGAGAGG - Intronic
1185641722 X:1592280-1592302 GCCAAGGGCCTGAGAATGTGTGG + Intronic
1187442022 X:19329196-19329218 GCCCCTGGCTGGAGAGTGAGGGG - Intergenic
1188785173 X:34336690-34336712 GCCCCTGGCCTGGAGATTTGTGG - Intergenic
1190322096 X:49185401-49185423 GTCTCTGACCTGGGAATGTGGGG - Intronic
1195133538 X:101878965-101878987 GCCCCTGACCTGAGAAGGTATGG + Intergenic
1196525874 X:116726764-116726786 GCCCCTGCCCTAAAAATATGTGG + Intergenic
1197480188 X:126974288-126974310 GCCCCTGCCCTAGGAATCTGTGG - Intergenic
1199329627 X:146543576-146543598 GCCCCTGCCCTGGGGATCTGTGG - Intergenic
1199976538 X:152897920-152897942 GACGCTGGCGGGAGAATGTGCGG + Intergenic