ID: 1060820950

View in Genome Browser
Species Human (GRCh38)
Location 9:126661425-126661447
Sequence CTCTGGGTATGGTGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060820942_1060820950 -6 Left 1060820942 9:126661408-126661430 CCAGGATGGGGCAGCTGCTCTGG 0: 1
1: 1
2: 9
3: 197
4: 1957
Right 1060820950 9:126661425-126661447 CTCTGGGTATGGTGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060820950 Original CRISPR CTCTGGGTATGGTGGGTGGA GGG Intronic
No off target data available for this crispr