ID: 1060821027

View in Genome Browser
Species Human (GRCh38)
Location 9:126661685-126661707
Sequence GGGCCCCGCAGCCACACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 255}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060821027_1060821037 21 Left 1060821027 9:126661685-126661707 CCTGCAGTGTGGCTGCGGGGCCC 0: 1
1: 0
2: 0
3: 31
4: 255
Right 1060821037 9:126661729-126661751 ATGCCAGGCCCCAGTGGGAGGGG No data
1060821027_1060821031 6 Left 1060821027 9:126661685-126661707 CCTGCAGTGTGGCTGCGGGGCCC 0: 1
1: 0
2: 0
3: 31
4: 255
Right 1060821031 9:126661714-126661736 AGCAGGCACCTGAGAATGCCAGG No data
1060821027_1060821033 15 Left 1060821027 9:126661685-126661707 CCTGCAGTGTGGCTGCGGGGCCC 0: 1
1: 0
2: 0
3: 31
4: 255
Right 1060821033 9:126661723-126661745 CTGAGAATGCCAGGCCCCAGTGG No data
1060821027_1060821036 20 Left 1060821027 9:126661685-126661707 CCTGCAGTGTGGCTGCGGGGCCC 0: 1
1: 0
2: 0
3: 31
4: 255
Right 1060821036 9:126661728-126661750 AATGCCAGGCCCCAGTGGGAGGG No data
1060821027_1060821034 16 Left 1060821027 9:126661685-126661707 CCTGCAGTGTGGCTGCGGGGCCC 0: 1
1: 0
2: 0
3: 31
4: 255
Right 1060821034 9:126661724-126661746 TGAGAATGCCAGGCCCCAGTGGG No data
1060821027_1060821039 26 Left 1060821027 9:126661685-126661707 CCTGCAGTGTGGCTGCGGGGCCC 0: 1
1: 0
2: 0
3: 31
4: 255
Right 1060821039 9:126661734-126661756 AGGCCCCAGTGGGAGGGGCTTGG No data
1060821027_1060821035 19 Left 1060821027 9:126661685-126661707 CCTGCAGTGTGGCTGCGGGGCCC 0: 1
1: 0
2: 0
3: 31
4: 255
Right 1060821035 9:126661727-126661749 GAATGCCAGGCCCCAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060821027 Original CRISPR GGGCCCCGCAGCCACACTGC AGG (reversed) Intronic
900103005 1:970818-970840 GTGCTCCGCAGCCACAGGGCAGG - Intronic
900213154 1:1467353-1467375 GGGCCCCTGAGCCACAGTGGCGG + Intronic
900218366 1:1494409-1494431 GGGCCCCTGAGCCACAGTGGCGG + Intronic
900220723 1:1508174-1508196 GGGCCCCTGAGCCACAGTGGCGG + Intergenic
900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG + Intronic
900511669 1:3063704-3063726 GGGCCCGGCGGCCACATTCCGGG - Intergenic
900660026 1:3777620-3777642 GGCCCATGCAGCCAAACTGCTGG - Intergenic
900690474 1:3977627-3977649 GGGCCCCTCATCCTCCCTGCTGG - Intergenic
901316722 1:8314843-8314865 GGGACCCTCAGCCTCACTGTGGG - Intergenic
902081222 1:13822125-13822147 GGACCCAGCAGTCCCACTGCAGG + Intronic
903298839 1:22363664-22363686 GGCCTCCCCAGCCACACTCCAGG + Intergenic
903375428 1:22862914-22862936 GGGCCATGCAGCACCACTGCTGG - Intronic
904279836 1:29411150-29411172 GAGCCCTGCAGCCAGACAGCTGG - Intergenic
904810191 1:33158428-33158450 GGGCCCCGCAGCCACCTTCAGGG + Intronic
904826598 1:33277337-33277359 AGGCTCTGGAGCCACACTGCCGG - Intronic
905202126 1:36322504-36322526 GGGCCCCGACGACACGCTGCCGG - Exonic
910113137 1:83702973-83702995 GGGCCTTGTACCCACACTGCAGG - Intergenic
910212104 1:84804120-84804142 GTGCCCCCCAGCCTCACTGAGGG + Intergenic
911371658 1:97002062-97002084 GGGCTCTGCAGTCATACTGCTGG - Intergenic
912413616 1:109494009-109494031 GGGCCACTCCGCCGCACTGCCGG + Intergenic
915748938 1:158186658-158186680 GGGCCCCGGAGGGACACAGCAGG + Intergenic
917724036 1:177812824-177812846 GAGCACAGCAGACACACTGCCGG - Intergenic
918078760 1:181190135-181190157 GGCCCCAGCAGCCCCGCTGCGGG - Intergenic
919403228 1:197146358-197146380 GGGCCCCGCAGCCCCGCGGGCGG + Exonic
919584159 1:199415699-199415721 AGCCTGCGCAGCCACACTGCCGG - Intergenic
920283226 1:204859638-204859660 GGGTCCCGCAGCTGCACTGAAGG + Intronic
920387415 1:205578758-205578780 AGGTCCAGCAGCCACACTGGAGG + Intronic
920871022 1:209795164-209795186 AGTCCCTGCAGCCAGACTGCTGG - Intronic
922620783 1:226986728-226986750 GTGGCCCGCAGCCCTACTGCTGG - Exonic
922821376 1:228487808-228487830 GGGGCCCGCAGCCATACGGCAGG - Exonic
922912668 1:229230560-229230582 GCACCCCACAGCCGCACTGCAGG + Intergenic
1064103690 10:12484055-12484077 GGTGCCCGCAGCCACAATCCTGG + Intronic
1067847371 10:49735121-49735143 GGGCCCCACAGCCCCTCTCCTGG + Exonic
1070346464 10:75547476-75547498 GGGCACCACAGCCCCAGTGCAGG - Intronic
1070753053 10:78975117-78975139 GGACCCCGCAGCCAGCCTGCTGG - Intergenic
1071718901 10:88123262-88123284 CAGCCCTGCAGCCCCACTGCAGG - Intergenic
1072040072 10:91598515-91598537 GGGCTCTGGAGCCAAACTGCTGG - Intergenic
1073024766 10:100479890-100479912 GGCACCAGCTGCCACACTGCTGG - Exonic
1074204187 10:111267829-111267851 GGGCCCCGGAGGGAGACTGCAGG - Intergenic
1076198982 10:128542895-128542917 TGTCGCCGCAGCCACTCTGCAGG + Intergenic
1076383096 10:130038460-130038482 GGGCCCCACAGCCTCACTTAAGG + Intergenic
1076620831 10:131786245-131786267 GGGCCTGTCAGCCACCCTGCAGG - Intergenic
1076830473 10:132991964-132991986 GGGCCCAGCAGCCACAGGGTGGG - Intergenic
1077185571 11:1234037-1234059 GGACACCCCGGCCACACTGCGGG - Intronic
1077430567 11:2513999-2514021 GGGCCCCACAGTGACACTGGGGG + Intronic
1081069626 11:38595169-38595191 GGGCCCAACATGCACACTGCAGG + Intergenic
1081807149 11:45896845-45896867 GGGCCCCGCAGCCCCCCGGCCGG + Intronic
1081991321 11:47339179-47339201 GGGCCCCACAGGGACCCTGCTGG + Intronic
1082973629 11:59050681-59050703 GGGCCCAGCATACAGACTGCTGG - Intergenic
1083333089 11:61908140-61908162 GGGCCCCGCAGCCGCCCAGCTGG - Exonic
1083541110 11:63512028-63512050 GGGACCGACAGCCCCACTGCTGG + Intronic
1083623447 11:64060011-64060033 GGGCCCCCCTCCCACACGGCAGG + Intronic
1084420610 11:69058706-69058728 AGGCCCCGCAGCAGCACAGCGGG - Intronic
1084492430 11:69486169-69486191 GGTCACTGCAGCCCCACTGCCGG + Intergenic
1084501547 11:69538437-69538459 GGGACCAGCAGCCACAAGGCAGG + Intergenic
1084615201 11:70231275-70231297 GGGCCACTGAGCCACACTTCCGG + Intergenic
1084730697 11:71071716-71071738 GGCCCCTCCAGCCACTCTGCTGG - Intronic
1086575763 11:88337658-88337680 GGGCCCAGCACCCATGCTGCAGG + Exonic
1092239594 12:6828724-6828746 GGGCCCCGGAGCCCGACTCCGGG + Exonic
1095088813 12:38085798-38085820 GGGCAGCCCAGCCACACTGATGG + Intergenic
1099989431 12:89708116-89708138 CGGCCCCCCAGACGCACTGCGGG - Intronic
1102107463 12:110337554-110337576 GGGCCCTGCAGCGATCCTGCTGG - Intronic
1102182441 12:110922698-110922720 CAGCCCCGCACCCACACTACTGG - Intergenic
1102454862 12:113065135-113065157 GGGACTCACAGCCACGCTGCAGG + Intronic
1104760945 12:131297301-131297323 GGGCCCCCGAGCCACACAGCTGG + Intergenic
1104818833 12:131663491-131663513 GGGCCCCCGAGCCACACAGCTGG - Intergenic
1104836594 12:131795909-131795931 GGGCCCCGCAGCCCTACTCCTGG + Intronic
1105242311 13:18619575-18619597 TGGCACCTGAGCCACACTGCTGG - Intergenic
1105329558 13:19402897-19402919 GGGCCCAACAGTCACACTGTGGG - Intergenic
1110095949 13:71521053-71521075 GGGCTCTGGAGCCAAACTGCTGG + Intronic
1112050606 13:95641730-95641752 GGGCCCCGAAGCCGCGCTGGGGG + Exonic
1113437870 13:110307280-110307302 GCGCACTGCAGCCACACTCCCGG - Exonic
1113653605 13:112055225-112055247 GCGCCCCGCACCGACACTGAGGG + Intergenic
1113655676 13:112066893-112066915 GGGCCCAGCAGCCATACGCCGGG - Intergenic
1113830271 13:113290315-113290337 GAGTCCCGCAGCCACACTGAAGG - Intergenic
1114065912 14:19059799-19059821 TGGCACCTGAGCCACACTGCTGG - Intergenic
1114096356 14:19340226-19340248 TGGCACCTGAGCCACACTGCTGG + Intergenic
1114699425 14:24662345-24662367 GGACTCCGCAGCCACACCACTGG - Intergenic
1117186743 14:53247489-53247511 TGTCCTCCCAGCCACACTGCCGG + Intergenic
1121016557 14:90552656-90552678 GTCCCCAGGAGCCACACTGCAGG - Intronic
1122232360 14:100313096-100313118 GGGGCCGGGAGCCCCACTGCGGG - Intergenic
1122408342 14:101513421-101513443 GGGACCCACAGCAACCCTGCAGG + Intergenic
1122628991 14:103098936-103098958 GGGCCCAGCAGGCACCTTGCTGG + Intergenic
1202947478 14_KI270726v1_random:41920-41942 GGTCCCCTCAGCCTCCCTGCAGG - Intergenic
1124382014 15:29175143-29175165 GGGCTCCAAAGCCAGACTGCCGG + Intronic
1127647585 15:60973859-60973881 GGGCTCCGCAGCCCCATGGCTGG - Intronic
1128768800 15:70266799-70266821 GGGGGCCGCAGCCAGACTGAGGG - Intergenic
1129206093 15:74037778-74037800 GGGCCCAGCAGCAAACCTGCAGG - Intronic
1129300927 15:74625048-74625070 GGGTCCAGCAGCCCCACTGAAGG - Intronic
1129379154 15:75154554-75154576 GAGCACCCCAGCCAGACTGCTGG - Intergenic
1130351216 15:83093438-83093460 GGACCCCTCAGCCTCACTCCTGG + Intergenic
1131067822 15:89445110-89445132 GTGCCCCCCAGCCAGGCTGCTGG - Intergenic
1132008076 15:98249076-98249098 GGGACCCACAGTCACCCTGCTGG - Intergenic
1132465535 16:75778-75800 GAGGCCAGCAGCCACCCTGCTGG + Intronic
1132570383 16:641654-641676 GGGCACCGCACTCAGACTGCTGG - Intronic
1132584288 16:699627-699649 GAGCCCCACGGCCACACTCCAGG + Intronic
1132833051 16:1938870-1938892 GGGCTGTGCAGCCACACTGTCGG - Exonic
1133255319 16:4512957-4512979 GGGCCACACAGCCACAGTCCTGG - Exonic
1133255613 16:4514076-4514098 GGGCCCCACAGCCCCACTTCTGG - Exonic
1135206901 16:20492145-20492167 GGGCGGGGCAGCCGCACTGCTGG - Intergenic
1135211984 16:20531487-20531509 GGGCGGGGCAGCCGCACTGCTGG + Intergenic
1135712423 16:24729463-24729485 GGCCCCCCCAGCCACTCCGCGGG + Intergenic
1138166299 16:54804815-54804837 GGGCCCTGGGGCCAGACTGCTGG + Intergenic
1138656363 16:58493934-58493956 GGGGCCCACAGACACTCTGCGGG - Intronic
1139960560 16:70715119-70715141 GGGCCTCCCAGCCACACTCCAGG + Intronic
1141758865 16:86013567-86013589 GAACCCCCCAGCCACACTCCAGG - Intergenic
1142860067 17:2755864-2755886 GGGCCCCGCAGCCTCAGCCCGGG - Intergenic
1143682430 17:8487344-8487366 GTGCCCCCCAGCTTCACTGCTGG + Intronic
1144672449 17:17140609-17140631 GTGCCCAGGAGCCAGACTGCTGG + Intronic
1146268342 17:31467970-31467992 GGGCCCTGCAGCCCCAGTGAAGG + Intronic
1147563330 17:41522056-41522078 CCGCCCCGCAGCCACATTCCAGG + Exonic
1148062860 17:44848590-44848612 GGGCCCTTGAGCCACACTGCTGG - Intronic
1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG + Intronic
1151774882 17:76193805-76193827 GGGTGCGGCAGCCTCACTGCAGG - Intronic
1151964700 17:77425318-77425340 GGGCCCCACAGCCACAGATCTGG - Intronic
1152161473 17:78671109-78671131 AGGCCCGGCAGCCACTCTGGTGG + Intergenic
1152207245 17:78980759-78980781 GGGGCCCCGGGCCACACTGCTGG + Intergenic
1152321205 17:79609746-79609768 GGTCCCCGCACCGACACTGCAGG + Intergenic
1152782040 17:82230978-82231000 GGGCCTCGAAGCCACAGGGCGGG - Intronic
1154304074 18:13218038-13218060 TGGCCGCGGAGCCGCACTGCGGG + Intronic
1154446638 18:14440303-14440325 TGGCACCTGAGCCACACTGCTGG + Intergenic
1155058473 18:22206317-22206339 GTGCTCTGGAGCCACACTGCAGG - Intergenic
1155910196 18:31497729-31497751 TGGCCCCGCAGCCACTGGGCCGG + Intergenic
1157921325 18:51715690-51715712 GGGCCCAGCTGCCAAACTGTGGG + Intergenic
1160364116 18:78309513-78309535 GGTCCCCGCAGCCGCGCTCCTGG - Intergenic
1160741264 19:687142-687164 GGCCTCAGCAGCCCCACTGCAGG + Exonic
1160765536 19:805988-806010 GGGCCCGGCCGCCCCAGTGCTGG + Intronic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1160802429 19:976585-976607 GCGCCCAGCATCCACACTGCAGG + Intergenic
1161013530 19:1971350-1971372 GGGCCACGAAGCCTCACTGCCGG + Intronic
1161055994 19:2190870-2190892 GAGCCCGGCAGCCACCCTGCAGG + Intronic
1161163407 19:2772972-2772994 GGGTGACGCAGCCACACGGCAGG + Intronic
1162738121 19:12757876-12757898 GGTCCCCGCAGCTGCACTCCGGG - Exonic
1163022873 19:14492856-14492878 TTGCCCCCCAGCCACACAGCTGG - Exonic
1164455118 19:28400386-28400408 GGGCCCCAAAGCCACTCTGCTGG - Intergenic
1165146234 19:33732501-33732523 GGCCCCAGCACCTACACTGCTGG - Intronic
1165161635 19:33820150-33820172 TGGCCCTGCAGCCAAACAGCGGG + Intergenic
1165416001 19:35693945-35693967 GGGCCCCTCTGCCTCACTCCAGG + Intergenic
1165990875 19:39812696-39812718 GGGCCCCCCACCCACCCTGGGGG + Intergenic
1166039025 19:40191360-40191382 GGGCCCCGAGGCCGCACGGCCGG + Intergenic
1168064073 19:53909462-53909484 GGGCCCCGCAGCCGCATGACCGG - Exonic
1168642406 19:58038933-58038955 GTGCCAGGCAGCCACGCTGCAGG + Intronic
925027829 2:623540-623562 GGGGCCAGGAGCAACACTGCAGG + Intergenic
925212409 2:2061253-2061275 GGCCCCCACAGCCAGGCTGCAGG - Intronic
925920958 2:8637519-8637541 GGGCCCCACACCCACACTTAGGG - Intergenic
926206113 2:10835326-10835348 GGGCTCCGGAGCCCGACTGCCGG - Intronic
932436284 2:71704167-71704189 GGCCCGCACAGCCACACGGCGGG + Intergenic
934527004 2:95058262-95058284 GGGCCCGGGAGCCACTCTGCTGG - Intergenic
934951681 2:98580121-98580143 GGGGCCCTCAGCTAAACTGCAGG - Intronic
936661416 2:114547978-114548000 AGGACCAGCAGCCCCACTGCAGG + Intronic
937221645 2:120345824-120345846 GGGCCCCGCAGCCCCGGTTCGGG - Intergenic
937227727 2:120379263-120379285 AGGACCCACAGCCACACTGCTGG - Intergenic
937984875 2:127633922-127633944 GAGCCCAGCAGCCAGACTGTGGG - Intronic
940615857 2:156047861-156047883 AGGCCCTGCAGCCACAATGTTGG - Intergenic
942329771 2:174810326-174810348 GCTCCCTGTAGCCACACTGCTGG - Intronic
944124550 2:196278532-196278554 AGGCAACGCAGCCACAGTGCGGG - Exonic
946165772 2:217862984-217863006 GGGCCCCTCACCCACACTGAGGG + Intronic
946367021 2:219254526-219254548 GAGCCCCGCAGCCTGTCTGCCGG + Intronic
948207252 2:236168694-236168716 GGGGCCCGCACCCCCACGGCTGG + Intergenic
948464000 2:238143547-238143569 GGGCCCCGCAGCGGCTCTGGAGG + Intronic
948537094 2:238654421-238654443 GGGCCAGGCAGCCTCCCTGCAGG - Intergenic
948972731 2:241441741-241441763 GGGCCCCCCCACGACACTGCCGG - Intronic
1169038958 20:2476875-2476897 GGGCACCAGAGCAACACTGCAGG - Intronic
1169118416 20:3081946-3081968 GGGCCCCTCAGCCAGAGTGGGGG - Intergenic
1169122731 20:3107067-3107089 GGGCCTCGCAGCCCAGCTGCAGG + Intergenic
1171414162 20:24966226-24966248 AGGCCCAGAAGCCACACTGAAGG + Intronic
1172448303 20:35004429-35004451 GGCCCCGGCAGACACACAGCAGG - Intronic
1172779941 20:37430546-37430568 GGGACCCTCAGACACACAGCAGG - Intergenic
1174107288 20:48171796-48171818 GGGCCCCAAAGCCCCCCTGCTGG + Intergenic
1174475893 20:50795299-50795321 GCGCCCCGCAGCCACCCTTCAGG - Intronic
1174507352 20:51024988-51025010 AGGCCCCTCCCCCACACTGCTGG - Intergenic
1174542736 20:51302862-51302884 TGGCCTCTCAGCCACAGTGCAGG + Intergenic
1175484225 20:59333498-59333520 GGGCCCCTCACCCCCACTGTGGG - Intergenic
1175776431 20:61656620-61656642 GGGCTCCACAGCCACTCTCCTGG + Intronic
1176104926 20:63381452-63381474 GGGCCCCCGAGCCACACAGGAGG - Intergenic
1176311894 21:5154909-5154931 ACACCCCGGAGCCACACTGCAGG + Intergenic
1176411671 21:6452484-6452506 AGGGGCCGCAGCCCCACTGCAGG - Intergenic
1176449341 21:6849538-6849560 TGGCACCTGAGCCACACTGCTGG - Intergenic
1179302717 21:40126984-40127006 GGGCCCTGGAGCCTCACTGCTGG + Intronic
1179687165 21:43060806-43060828 AGGGGCCGCAGCCCCACTGCAGG - Intronic
1179845153 21:44107122-44107144 ACACCCCGGAGCCACACTGCAGG - Intergenic
1179886380 21:44315944-44315966 GGGCCCAGCACACACACAGCTGG - Intronic
1179974031 21:44853591-44853613 GGGCCCAGCAGCATCTCTGCAGG - Intronic
1180205318 21:46256075-46256097 GGGCCTAGCAGGCACACCGCTGG - Intronic
1180484392 22:15782391-15782413 TGGCACCTGAGCCACACTGCTGG - Intergenic
1180699827 22:17775135-17775157 GGGCTCTGCAGCAGCACTGCCGG - Intergenic
1180876501 22:19177582-19177604 GGGCCCCGCGGTCACCCCGCCGG + Intronic
1182421155 22:30249156-30249178 GGGGGCCGCAGCCACGTTGCAGG - Intergenic
1182752629 22:32654053-32654075 GGGCCCAGTACCCACACTGGGGG + Intronic
1183508857 22:38223537-38223559 GGGCCGCGGAGCCCCGCTGCAGG + Intronic
1183538593 22:38417083-38417105 GGGCCCCTCACCCAGGCTGCGGG + Intergenic
1184647364 22:45903519-45903541 GGGCCTCCCTGCCACACTCCTGG - Intergenic
1185052989 22:48563402-48563424 GGGCCCAGCCTCCACACTGCCGG - Intronic
1185275690 22:49949429-49949451 TGGCCTCGCAGCCACCCTCCCGG + Intergenic
950407021 3:12811098-12811120 GGGCCTTGCAGGCACACGGCGGG + Intronic
950534465 3:13571135-13571157 GGGTCCCCCAGCCCCAGTGCAGG + Exonic
952303326 3:32123913-32123935 GGGACCTGCGGCCACACTGCTGG - Intronic
953391677 3:42537391-42537413 GGCCTCCTCAGCCACACTCCAGG - Exonic
953903509 3:46856874-46856896 GGGGCCCCCAGCCTCTCTGCAGG + Intergenic
953904915 3:46863742-46863764 GGGCCCTGCTGCCTCTCTGCAGG + Intronic
956705478 3:71995440-71995462 GGGCCCCTCTGCCACATTGGAGG - Intergenic
959694485 3:109234579-109234601 AAGCCCTGCAGCCACAGTGCTGG - Intergenic
960996387 3:123343274-123343296 GGGACCACCAGCCACATTGCAGG - Intronic
961324620 3:126102904-126102926 GGGTCCCACAGGCCCACTGCAGG - Intergenic
961778350 3:129306039-129306061 GGCCCCCGCCTCCACAGTGCAGG - Exonic
967971830 3:195004992-195005014 GGGCCACCCACCCACAGTGCAGG + Intergenic
968521258 4:1035779-1035801 GGCCCCCGCAGCTCCTCTGCAGG - Intergenic
968608051 4:1544902-1544924 GGGCCACGCAGCCCCAGGGCGGG - Intergenic
968946423 4:3666918-3666940 GGGCCCAGCAGCAACTCTGCAGG - Intergenic
969327623 4:6452944-6452966 GCTCCCCACGGCCACACTGCAGG + Intronic
969529953 4:7725143-7725165 GGTCCCCACAGCCCCCCTGCAGG + Exonic
969912878 4:10461452-10461474 CGGGCTCGCAGCGACACTGCAGG - Intergenic
972586169 4:40438674-40438696 AGACCTCGCAGCCACGCTGCGGG + Exonic
975778789 4:77818985-77819007 GGGAGCCGCAGCCACAAAGCGGG + Intronic
975813856 4:78197203-78197225 GGGCTCTGAAGTCACACTGCTGG + Intronic
976218775 4:82739452-82739474 GGGTGCTGCACCCACACTGCTGG - Intronic
980386294 4:132090713-132090735 GAGCACAGCAGACACACTGCCGG + Intergenic
984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG + Intronic
985112617 4:186561630-186561652 CAGCCCCTCAGCCACACTGTGGG - Intergenic
987237443 5:15957295-15957317 GACCCCAGCAGCCACCCTGCAGG + Intergenic
990016042 5:51063810-51063832 AGGCCCTGCAGCCACAGTGTTGG - Intergenic
995784688 5:115816038-115816060 GGGCTCCGCGGCCACAGCGCAGG - Intronic
995885256 5:116887486-116887508 GGGCCCAGCTGCAAGACTGCAGG - Intergenic
997677769 5:135726168-135726190 TGGCCCTGCTGCTACACTGCTGG - Intergenic
997714054 5:136029103-136029125 GGGCCCCGCCGCGACCCTGGCGG + Exonic
999301087 5:150490875-150490897 GGGCCCTGCAGTCACACAGCAGG - Intronic
1001471948 5:172020732-172020754 GGGCCCTGCTGGCACATTGCTGG + Intergenic
1001993549 5:176135687-176135709 GGGCCCCGCTTCTACTCTGCTGG - Intergenic
1002067426 5:176658949-176658971 GGGCCAAGGAGCCACATTGCTGG - Exonic
1002616904 5:180461658-180461680 GGGAGCCACAGCCACACTGCAGG + Intergenic
1003566829 6:7229572-7229594 GGCCCCTGCCGCCCCACTGCAGG + Exonic
1004359812 6:14961187-14961209 TGGCTCAGCAGCCACACTGGTGG + Intergenic
1008544346 6:52572709-52572731 AGGACCCGCAGCCACATTTCAGG + Intronic
1009320789 6:62286109-62286131 GGGCCACGCAGCCCGACGGCGGG - Exonic
1016388633 6:143553075-143553097 TAGCCCCTCAGCCACACTTCTGG - Intronic
1016869601 6:148803715-148803737 GGCCTCCTCAGCCACACTGAAGG - Intronic
1017939156 6:159036198-159036220 GGGCCCGGCAGCCAGACTAGTGG - Exonic
1018472120 6:164106477-164106499 GGACCCCGCAGCCCCGATGCAGG - Intergenic
1018820509 6:167370213-167370235 GGGCCCGGCAGCCACCTTGCAGG - Intronic
1019290078 7:246024-246046 GGGACCCACAGTCACACCGCAGG - Intronic
1019357887 7:590460-590482 GGGCCCCGCCCCCACCCTGCTGG - Intronic
1019508190 7:1403916-1403938 TGGCCCGGCATCCACACTCCTGG + Intergenic
1021161182 7:17274757-17274779 AGGCACCGCAACTACACTGCAGG + Intergenic
1023855994 7:44184545-44184567 GGGCCCCGCAGCTCCCCAGCTGG + Intronic
1024315243 7:48009954-48009976 GGGCCCGGAAGACACACAGCAGG - Intronic
1025263545 7:57438464-57438486 GTGCCCGGCAGCCACACACCAGG - Intergenic
1026982581 7:74535556-74535578 GGGCTCTGGAGTCACACTGCTGG - Intronic
1029283831 7:99452990-99453012 GGGCCCCACAGCCAAGCAGCTGG + Intronic
1029849466 7:103446991-103447013 GAGCACCGCAGCCAGAGTGCCGG + Intergenic
1030661162 7:112221094-112221116 GAGCCCAGCAGACACCCTGCTGG - Intronic
1034966681 7:155395667-155395689 GGTCCCAGCACTCACACTGCGGG + Exonic
1036560737 8:9898720-9898742 GAGGCCCGGAGCCGCACTGCGGG + Intergenic
1037401274 8:18497462-18497484 GGGCCCTGCAGCCAGACACCTGG - Intergenic
1037539120 8:19855077-19855099 CGGACCCGGAGCCACACTGTGGG + Intergenic
1037835624 8:22213308-22213330 GGGCCCTGGGGCCACACTGGTGG - Intergenic
1037896478 8:22659673-22659695 GGGCCCTGGAGCCAGACAGCTGG + Intronic
1037906448 8:22718576-22718598 GGGCCTGGCAGCCACCCAGCTGG - Intronic
1041021377 8:53642430-53642452 AGGCCCTGCAGCCCCACTGTTGG + Intergenic
1043965538 8:86470525-86470547 GGACCCAGGAGCCACACTCCTGG + Intronic
1044038629 8:87337421-87337443 AGGCCCTGCAGCCACAGTGTTGG + Intronic
1045431880 8:102122776-102122798 GGGCTCTGCAGCCAGACAGCCGG - Intronic
1046355744 8:113082242-113082264 GGGCCCATCACCCCCACTGCTGG + Intronic
1049102273 8:140588290-140588312 GCGCACCTCAGTCACACTGCAGG + Intronic
1049392760 8:142380574-142380596 GGGCTCCCCAGCCAGACTGTAGG + Intronic
1054791006 9:69256680-69256702 GGGTCCATCAGGCACACTGCTGG - Intergenic
1056793140 9:89639185-89639207 GGCCCCAGGAGCCACACTGCGGG - Intergenic
1058109457 9:101016404-101016426 GTGATCCGCAGCCACTCTGCAGG - Intergenic
1058662891 9:107282922-107282944 GGGCTCCGCATCCACTCTGCCGG + Intergenic
1060550498 9:124482680-124482702 CGGGGCCGCAGCCACACCGCTGG - Exonic
1060790545 9:126482878-126482900 GCGCCCCGCAGCCCCACTACGGG + Intronic
1060821027 9:126661685-126661707 GGGCCCCGCAGCCACACTGCAGG - Intronic
1061037205 9:128120485-128120507 GAGCCCAGCAGCCAGAGTGCAGG - Intergenic
1061207806 9:129174612-129174634 GAGCCTCGCAGCCACCCCGCAGG - Intergenic
1062584147 9:137241511-137241533 GGGCCCGGCGGCCGCAATGCGGG - Intronic
1062601178 9:137319265-137319287 TGCCACCGCAGCCACAGTGCAGG - Intronic
1062684576 9:137803985-137804007 GGACCCCCCAGCCACGCTGAAGG - Intronic
1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG + Intronic
1190499397 X:51059975-51059997 GGCACCCGCAGCCACAGTTCTGG - Intergenic
1192436094 X:71144843-71144865 GGGCACAGCAGCCAGGCTGCCGG + Exonic
1192691646 X:73371876-73371898 GGGCTCCTCTTCCACACTGCAGG + Intergenic
1195379661 X:104258276-104258298 GGACCCTGAAGCCAGACTGCTGG + Intergenic
1196858216 X:120003009-120003031 GGACCCTGGAGCCAGACTGCTGG + Intergenic
1196860031 X:120017877-120017899 GGACCCTGGAGCCAGACTGCTGG + Intergenic
1199991952 X:152992501-152992523 GGTCCCCACTGCCAGACTGCAGG + Intronic
1200179617 X:154142415-154142437 GGACCCAGCAACCGCACTGCTGG - Intergenic
1200965205 Y:9029040-9029062 GGGCCCCTCAGCAGCACTACTGG - Intergenic
1202147905 Y:21819742-21819764 GGGCCCCTCAGCAGCACTACTGG + Intergenic