ID: 1060823510

View in Genome Browser
Species Human (GRCh38)
Location 9:126674510-126674532
Sequence GTCAGGGATCTCCCCACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060823510_1060823517 24 Left 1060823510 9:126674510-126674532 CCTGGTGTGGGGAGATCCCTGAC 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1060823517 9:126674557-126674579 GGCAGTCAGTGCAGTGAGCCAGG No data
1060823510_1060823516 3 Left 1060823510 9:126674510-126674532 CCTGGTGTGGGGAGATCCCTGAC 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1060823516 9:126674536-126674558 AAGATGAACGGATGCTGTGCTGG No data
1060823510_1060823511 -9 Left 1060823510 9:126674510-126674532 CCTGGTGTGGGGAGATCCCTGAC 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1060823511 9:126674524-126674546 ATCCCTGACCCAAAGATGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060823510 Original CRISPR GTCAGGGATCTCCCCACACC AGG (reversed) Intronic
900124607 1:1063922-1063944 GCCAGGGGCCTCCCCAGACCAGG - Intergenic
901989437 1:13100802-13100824 CTCAGGGATCTTCCCACAGTGGG + Intergenic
901992376 1:13125962-13125984 CTCAGGGATCTTCCCACAGTGGG - Intergenic
903121178 1:21217925-21217947 GACAGTGCTCTCCCCTCACCCGG - Intronic
904945550 1:34196394-34196416 TGCAGGGATCTCCCCACTGCTGG + Intronic
910170663 1:84373261-84373283 GTCAGGTATCACCACACACATGG + Intronic
913333139 1:117683808-117683830 GGCAGGGATGTTCCCACACAGGG - Intergenic
915839305 1:159202231-159202253 GTCAGGGTTCACACCTCACCTGG + Intronic
917973642 1:180224883-180224905 TGCAGGGATCTCTCCCCACCAGG - Intergenic
918223059 1:182453742-182453764 GTCAGTGAGCTCCCCACAGCTGG + Intronic
919893851 1:201996150-201996172 GGCAGGGCTCAGCCCACACCCGG - Exonic
1063003528 10:1946581-1946603 GGCTGGGATCTGCCCACTCCGGG - Intergenic
1069316296 10:67107739-67107761 GCCAGGGACCCCCTCACACCTGG - Intronic
1070276894 10:75015941-75015963 GACAGGGATCTCCCCCGACAGGG - Intronic
1074161037 10:110836511-110836533 GTCCGTGATGTCCCCTCACCAGG - Exonic
1075265847 10:120999148-120999170 ATCAGGGATCCCCCCACCCAAGG - Intergenic
1075322100 10:121499688-121499710 GCCTGGGTCCTCCCCACACCTGG + Intronic
1076333707 10:129691128-129691150 GTCAGCCTTCTCCCCACGCCGGG - Intronic
1081381622 11:42423524-42423546 GACAGGGAACGCCACACACCGGG + Intergenic
1082804374 11:57438188-57438210 GTCAGGTATCATCCCACACCTGG + Intergenic
1083375848 11:62220271-62220293 GTCCTGGATCTCTCCCCACCAGG - Intergenic
1084839541 11:71833835-71833857 ACCAGGGATGACCCCACACCAGG + Intronic
1085519734 11:77130931-77130953 CCCAGGGACCTTCCCACACCTGG - Intronic
1087780518 11:102296811-102296833 GTCAGGGAACATCACACACCAGG - Intergenic
1091115194 11:133006122-133006144 TCCAGGGATCTCCTCCCACCTGG - Intronic
1091777509 12:3194144-3194166 GTCAGTGACCACCCCACAGCAGG - Intronic
1092365122 12:7871410-7871432 GCCAGTCATCTCCCCACCCCCGG + Intronic
1096411284 12:51378832-51378854 GTTAGGAATATCCTCACACCTGG - Intronic
1099511506 12:83544553-83544575 GTCAGGGAACATCACACACCGGG - Intergenic
1100797679 12:98199334-98199356 GGCAGGGAACACCACACACCAGG - Intergenic
1104017126 12:124968795-124968817 CTCAGGGGGCTCCCGACACCAGG + Intronic
1104940114 12:132391138-132391160 GTCAGGGATGCAGCCACACCAGG + Intergenic
1105547344 13:21360498-21360520 GTCAAAGCTCTCCCCACACAGGG + Intergenic
1113834884 13:113322238-113322260 GTCAGGGCTCTGCTCACACAGGG - Intronic
1115027508 14:28761580-28761602 GTCATGGATCTTTCCACGCCTGG + Intergenic
1121007198 14:90498053-90498075 GGCAGAGGTCCCCCCACACCTGG - Intergenic
1202868763 14_GL000225v1_random:140068-140090 GTCTGGGATCTGCCCACAGAGGG + Intergenic
1125592653 15:40864448-40864470 GAGAGGGATCTCACCACCCCTGG + Intergenic
1127142556 15:55993144-55993166 GCCTGGGAGCTCCGCACACCCGG + Intronic
1127857128 15:62962102-62962124 GTGAGTGTACTCCCCACACCAGG - Intergenic
1127864120 15:63017841-63017863 GGCAGGGACCTGCCCTCACCAGG - Intergenic
1131993274 15:98110466-98110488 TGGAGGGACCTCCCCACACCTGG + Intergenic
1132680772 16:1140843-1140865 GTCCGGGGTCTCCCCATCCCAGG + Intergenic
1133775857 16:8894527-8894549 GTAAGGGTTCTCCCCCCCCCGGG - Intronic
1136518243 16:30780695-30780717 GCAAGGGTTCTCCCCACACCAGG - Exonic
1136552875 16:30990853-30990875 CTCAGGCTGCTCCCCACACCAGG - Exonic
1138528028 16:57620112-57620134 GTGAGGGACCTGCCCAGACCTGG + Exonic
1138656647 16:58495448-58495470 GTCAGGCATTTTCCCAGACCCGG - Intronic
1138705890 16:58914549-58914571 GGCAGGGAACATCCCACACCTGG - Intergenic
1139299282 16:65931372-65931394 GGCAGGGAACATCCCACACCAGG + Intergenic
1139365154 16:66428168-66428190 GGCAGGGCCCACCCCACACCCGG + Intronic
1139377353 16:66508554-66508576 TTGAGGGAGCTCCCCACCCCAGG + Exonic
1140126292 16:72121529-72121551 GGCAGGCATCTCCAAACACCTGG - Intronic
1141760492 16:86025845-86025867 GTCAGGAGGCTCCCCACCCCCGG + Intergenic
1141800938 16:86308797-86308819 GTCAGGCCTCTCCCTAGACCTGG - Intergenic
1142519757 17:496721-496743 ATCAGGGGACTCCCCACACTGGG - Intergenic
1143124493 17:4632889-4632911 TTCAGTGATCTCTCGACACCAGG + Exonic
1143445465 17:7006557-7006579 CTCCGTGATCTCCCGACACCAGG - Exonic
1144583558 17:16474141-16474163 GTCATGGCTCTGCCCACACGTGG + Intronic
1144679366 17:17182721-17182743 GTCAGGGCGCTCCCCTCCCCTGG + Intronic
1146557640 17:33840285-33840307 TTCTGGGAACTCCCCACACTGGG - Intronic
1148763814 17:50026081-50026103 ACCAGTGATCTCACCACACCTGG + Intergenic
1150125344 17:62631337-62631359 GTCAGAGATTTGCACACACCTGG + Intronic
1150578956 17:66454930-66454952 GTCAGGCACCTGCCCTCACCTGG - Intronic
1151786194 17:76276183-76276205 GTCAGAACTCACCCCACACCTGG - Intronic
1156373405 18:36491066-36491088 TTCTGTGATCTCCCCACACCAGG - Intronic
1158865805 18:61636699-61636721 TCCAGGAATCTCCTCACACCTGG - Intergenic
1160144592 18:76353222-76353244 CGCTGGGATCTCCCCAGACCTGG - Intergenic
1160500631 18:79399865-79399887 GGCTGGGACCTCCCCACTCCCGG + Intronic
1160628292 18:80228314-80228336 GTCCGGGAACTCCCCTCCCCTGG - Intronic
1161421602 19:4178964-4178986 CTCAGAGATCTCCACACACTGGG + Intronic
1161771479 19:6233401-6233423 ATCAGGGCTTTCCCCACACAAGG - Intronic
1162259875 19:9523895-9523917 GTCAGGGATCCCCAAACCCCTGG - Intergenic
1162564152 19:11435904-11435926 GGCAGCGATCTCCCCAATCCTGG - Intronic
1163184018 19:15623796-15623818 GACAGGGGTCTCTCCACTCCAGG + Intronic
1165135988 19:33669179-33669201 GTCAGGCATCCATCCACACCCGG - Intronic
1166264026 19:41665890-41665912 GGCAGGAATTTCCCCACGCCAGG + Intronic
1167305124 19:48703696-48703718 GTCAATGTTCTCCCGACACCAGG - Exonic
1168065732 19:53919306-53919328 GACAGGGATTGCCCCAGACCTGG + Intronic
927141200 2:20131993-20132015 GTCAGAGATCCCCCCATATCAGG - Intergenic
927849985 2:26492961-26492983 TTAAGGGATCTCCCTCCACCAGG - Intronic
929606856 2:43240544-43240566 GCCAGGGCTCTCCACCCACCAGG + Intronic
930872356 2:56182950-56182972 GGCAAGGATCTACCCCCACCGGG - Intergenic
931542957 2:63350259-63350281 GGCAGGGAACATCCCACACCGGG + Intronic
932644727 2:73488396-73488418 GCCAGGCCTCTCCCCACTCCTGG - Intronic
934686409 2:96325228-96325250 GGCAGCGGCCTCCCCACACCGGG - Intergenic
935653223 2:105399344-105399366 GGCAGGGGTCTGCCCACGCCGGG + Intronic
936009539 2:108916641-108916663 CTCAGGGATCCCTGCACACCAGG - Intronic
938140544 2:128791328-128791350 GACAGGGCTCCCCCCACACATGG + Intergenic
941404736 2:165074515-165074537 GTCTGGCCTCTCCCCACTCCTGG + Intergenic
943425803 2:187732148-187732170 AGCAGGGACCTGCCCACACCTGG + Intergenic
948231846 2:236354814-236354836 GACAGGGAGCACCCCACACAGGG - Intronic
948371603 2:237493097-237493119 GTCAGTGATCTCCCCATCCAGGG - Intronic
948728654 2:239949933-239949955 GTCAGGGCTCTCCTGAGACCAGG - Intronic
1168764684 20:373676-373698 GTAAGGGAGGTCCCCACACAGGG + Intronic
1173800995 20:45894487-45894509 GGCAGGAATCTTCCCAGACCTGG - Intronic
1177037496 21:16061254-16061276 GCCTGGCATCTCCCCACTCCTGG - Intergenic
1177594206 21:23214080-23214102 TTCAGGCAGTTCCCCACACCTGG + Intergenic
1179417109 21:41207844-41207866 TTCAGGGATCACCCCCGACCAGG - Intronic
1179726386 21:43343700-43343722 TTCAGGGACCTCCCCAGAGCGGG - Intergenic
1180535203 22:16389552-16389574 CTGAGTGATCTCCCCAGACCGGG - Intergenic
1182779505 22:32856410-32856432 GTCACTGATCTACCCACCCCAGG - Intronic
1184292936 22:43508010-43508032 CTCTGGGATCCCCCCACCCCAGG - Intergenic
1184479678 22:44739117-44739139 GTCTGGGCTCTGTCCACACCAGG + Intronic
951942532 3:28095445-28095467 GGCAGGGAACTTCACACACCAGG - Intergenic
953387337 3:42514028-42514050 GGCTGGGAGCTCCCCAGACCTGG - Intronic
954127947 3:48543242-48543264 GGCAGGATTCTCCCCACACCAGG + Intronic
958195177 3:90235123-90235145 GCCAGGCTTCTCCCCACAGCAGG + Intergenic
960664395 3:120095229-120095251 GTCAGGCATCTCCCCGCTCCTGG - Intergenic
961168543 3:124780038-124780060 CTCAGGGAGCTCCCCACGCAGGG - Intronic
962913561 3:139877627-139877649 GTCAGGGAACATCACACACCAGG - Intergenic
963801691 3:149682780-149682802 GACAGAGATCTCCCCACCCTAGG + Intronic
966256024 3:177917592-177917614 GTCTGGCCTCTCCCCACTCCTGG + Intergenic
968519072 4:1027631-1027653 GTCAGGGACCTCTCCCCAACTGG + Intergenic
968554977 4:1242271-1242293 GTCACTGAGCTGCCCACACCTGG + Intronic
969401871 4:6961229-6961251 GTCAGGGATCAGGCCACACCCGG - Intronic
969514257 4:7637808-7637830 GTCAGGCTTCTCCTTACACCAGG - Intronic
970565074 4:17323938-17323960 CTCATGTATCTTCCCACACCAGG - Intergenic
971771903 4:30908068-30908090 GGCAGGGAACACCACACACCAGG + Intronic
976748260 4:88427623-88427645 GGCAGGGATTTCCCAACCCCAGG + Intronic
976921540 4:90449737-90449759 GTCTGGCCTCTCCCCACACCTGG - Intronic
984752865 4:183295778-183295800 GTCAGGGATCTCGGCACCCTGGG - Intronic
985371061 4:189285310-189285332 CTCAGGGGTCTCCCCAAAGCGGG + Intergenic
985843310 5:2325834-2325856 GGCAGGCATCTTCCCAAACCTGG + Intergenic
990197017 5:53329259-53329281 TTCAGGGATCACCCAACAACTGG + Intergenic
990986477 5:61645086-61645108 GACAGGGCTCTCCCTACTCCTGG - Intronic
992335211 5:75760232-75760254 GGCAGGGAACATCCCACACCGGG - Intergenic
993961044 5:94296681-94296703 GGGAGGGATGTCCCCTCACCCGG - Intronic
998076647 5:139241944-139241966 GCCTGGGACCTCCCCACCCCTGG + Intronic
1000282373 5:159793303-159793325 GTGAGGGAGAACCCCACACCTGG - Intergenic
1001423105 5:171601740-171601762 GCCAGGGCTCTCCACACTCCAGG + Intergenic
1001818858 5:174694068-174694090 GTCAGGGAACCCTCCACCCCAGG + Intergenic
1003851426 6:10226713-10226735 TTCAGGGATATCCCCACTTCTGG - Intergenic
1004864168 6:19837406-19837428 GCCCGGGATCACCCCACTCCCGG - Exonic
1005025350 6:21457910-21457932 TCCAGGGATCTCCTCCCACCTGG + Intergenic
1006670515 6:35727470-35727492 GTCTGGGCTCTCCCTACTCCCGG + Intronic
1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG + Intronic
1010999677 6:82573584-82573606 GCCTGGGATCTCCCAACAGCTGG - Intergenic
1011405763 6:87014079-87014101 GGCAGGGAACACCACACACCCGG + Intronic
1011637657 6:89389114-89389136 GTCAGGGATCCCCAAACCCCGGG - Intronic
1012962427 6:105636200-105636222 GTCAGGGATTTCCTCACAATGGG + Intergenic
1017343369 6:153352809-153352831 TTCAGGGATCTCCTCCCACCTGG - Intergenic
1018918196 6:168151137-168151159 GGCAGGGATCTCCGCCCACATGG - Intergenic
1019181591 6:170190585-170190607 GACTGGGGTCTCCCCACAGCAGG - Intergenic
1019181613 6:170190737-170190759 GACTGGGGTCTCCCCACAGCAGG - Intergenic
1019181635 6:170190889-170190911 GACTGGGGTCTCCCCACAGCAGG - Intergenic
1019181694 6:170191269-170191291 GACTGGGGTCTCCCCACAGCAGG - Intergenic
1019181724 6:170191459-170191481 GACTGGGGTCTCCCCACAGCAGG - Intergenic
1019181735 6:170191535-170191557 GACTGGGGTCTCCCCACAGCAGG - Intergenic
1019181756 6:170191687-170191709 GACTGGGGTCTCCCCACAGCAGG - Intergenic
1019181763 6:170191725-170191747 GACTGGGGTCTCCCCACAGCAGG - Intergenic
1019181787 6:170191915-170191937 GACTGGGGTCTCCCCACAGCGGG - Intergenic
1021574328 7:22093896-22093918 GTCAGGCATCTCCCCTTCCCAGG + Intergenic
1023007606 7:35889237-35889259 GTCAGGCAGCTCCCTACTCCTGG - Intronic
1024894876 7:54246217-54246239 CCCAGGGGTCTCCCCACCCCTGG + Intergenic
1027911734 7:84260547-84260569 GTCTGGCCTCTCCCCACTCCCGG + Intronic
1029712399 7:102306947-102306969 GTCTGGGAACCCCCCACACCAGG - Intronic
1030632484 7:111910899-111910921 GACAGGTACCTCCTCACACCAGG + Intronic
1037914390 8:22763907-22763929 TTCATGGCTCTCTCCACACCTGG - Intronic
1040597005 8:48848063-48848085 GTCCAGGCTCTCCCAACACCTGG + Intergenic
1041634235 8:60124841-60124863 GTCAGGGAACATCACACACCAGG - Intergenic
1046017219 8:108619516-108619538 GCCAGGGGTCTCCCAGCACCTGG - Intronic
1051275364 9:15393218-15393240 GCCAGGTATCCCCCCACACCTGG - Intergenic
1051665499 9:19464295-19464317 GGCAGGGGTCTCCACACCCCAGG - Intergenic
1051752210 9:20354378-20354400 GTTAGGGCTCTGCCCAAACCAGG + Intronic
1056683466 9:88740168-88740190 GTCCTGGATCTGCCCCCACCTGG - Intergenic
1057315239 9:93964185-93964207 GTCTGGAAGCTCCCCACCCCCGG - Intergenic
1060405748 9:123372310-123372332 ATCAGGGACCTCCTCACACGTGG - Exonic
1060504337 9:124187030-124187052 TTCAGGGAGCTCCCCACTCCTGG - Intergenic
1060823510 9:126674510-126674532 GTCAGGGATCTCCCCACACCAGG - Intronic
1061980651 9:134101626-134101648 GCCCGGGATGCCCCCACACCGGG - Intergenic
1062003071 9:134226495-134226517 GTCTGGGAGCTTCCCACCCCGGG - Intergenic
1062206222 9:135338890-135338912 GCCAAGGGGCTCCCCACACCAGG - Intergenic
1203736013 Un_GL000216v2:140185-140207 GTCTGGGATCTGCCCACAGAGGG - Intergenic
1186968590 X:14815139-14815161 GGCAGGGAACACCACACACCAGG + Intergenic
1189215127 X:39316525-39316547 GGCAGGGAACACCACACACCGGG + Intergenic
1192249741 X:69401841-69401863 ATCAGGGATCTTTGCACACCAGG + Intergenic
1193031738 X:76906404-76906426 GTCAGGCATTTTCCCAGACCTGG + Intergenic
1197061735 X:122189969-122189991 GCCAGGGATCCCCTCCCACCTGG - Intergenic
1197113622 X:122805280-122805302 GTCAGGGAACATCACACACCAGG + Intergenic
1199255705 X:145716344-145716366 TTCAGGGATCCCCTCCCACCTGG - Intergenic
1199449264 X:147961366-147961388 GTCAATGCTCTCCACACACCTGG - Intergenic
1202624806 Y:56846350-56846372 GTCTGGGATCTGCCCACAGGGGG + Intergenic