ID: 1060826532

View in Genome Browser
Species Human (GRCh38)
Location 9:126691067-126691089
Sequence CGGTGAGGCCTGGCCTGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 296}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060826526_1060826532 -6 Left 1060826526 9:126691050-126691072 CCCGACGAGTCCGACTCCGGTGA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 296
1060826525_1060826532 -5 Left 1060826525 9:126691049-126691071 CCCCGACGAGTCCGACTCCGGTG 0: 1
1: 0
2: 0
3: 0
4: 6
Right 1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 296
1060826523_1060826532 2 Left 1060826523 9:126691042-126691064 CCGTGAGCCCCGACGAGTCCGAC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 296
1060826522_1060826532 13 Left 1060826522 9:126691031-126691053 CCTGCTCAGCTCCGTGAGCCCCG 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 296
1060826527_1060826532 -7 Left 1060826527 9:126691051-126691073 CCGACGAGTCCGACTCCGGTGAG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060826532 Original CRISPR CGGTGAGGCCTGGCCTGAGC TGG Exonic