ID: 1060826532

View in Genome Browser
Species Human (GRCh38)
Location 9:126691067-126691089
Sequence CGGTGAGGCCTGGCCTGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 296}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060826523_1060826532 2 Left 1060826523 9:126691042-126691064 CCGTGAGCCCCGACGAGTCCGAC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 296
1060826526_1060826532 -6 Left 1060826526 9:126691050-126691072 CCCGACGAGTCCGACTCCGGTGA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 296
1060826522_1060826532 13 Left 1060826522 9:126691031-126691053 CCTGCTCAGCTCCGTGAGCCCCG 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 296
1060826525_1060826532 -5 Left 1060826525 9:126691049-126691071 CCCCGACGAGTCCGACTCCGGTG 0: 1
1: 0
2: 0
3: 0
4: 6
Right 1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 296
1060826527_1060826532 -7 Left 1060826527 9:126691051-126691073 CCGACGAGTCCGACTCCGGTGAG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060826532 Original CRISPR CGGTGAGGCCTGGCCTGAGC TGG Exonic
900412192 1:2517659-2517681 GGGTTTGCCCTGGCCTGAGCTGG - Intronic
900604067 1:3516081-3516103 AGGTGTGGCCTGGCCTGGGGTGG - Intronic
900646955 1:3713337-3713359 CAGTGAGGCCAGGCCTGGGAGGG - Intronic
901508961 1:9704979-9705001 CGGTGAGGCCTGGGCCCAGCCGG + Intronic
901815018 1:11788943-11788965 CGGGTGGGCCTGGCCTGAGCTGG - Exonic
901868751 1:12125314-12125336 CGGCCTGGCCTGGCCTGGGCTGG + Intronic
901871744 1:12142526-12142548 AAGTGAGGCCTGGGCTGGGCTGG + Exonic
901873300 1:12151271-12151293 GGGAGAGGCCTGGCCACAGCTGG - Intergenic
902449759 1:16489664-16489686 AGGTGAGGCCTGGCCAGGGATGG - Intergenic
902504678 1:16931396-16931418 AGGTGAGGCCTGGCCGGGGACGG + Exonic
902604784 1:17562980-17563002 AGTTGAGGACTGGCCTGTGCAGG + Intronic
902614442 1:17616201-17616223 CGGTGAGGCGCTGCCCGAGCGGG + Exonic
903193442 1:21669025-21669047 GGGGGAGGCCTGGACTGAGCCGG - Intronic
903542715 1:24105937-24105959 TGGTGAGGCCTGGACAGTGCAGG + Exonic
903672887 1:25046870-25046892 CGATGCTGCCTGACCTGAGCAGG - Intergenic
904481792 1:30798599-30798621 CCGGGAGGGCTGGACTGAGCTGG - Intergenic
905709223 1:40086601-40086623 GGGGGAGACCTGACCTGAGCTGG + Intronic
905793210 1:40801191-40801213 GGGTGAGTCCTGGGCTGACCAGG + Intronic
906059096 1:42936649-42936671 CCGGGAGGCCTGGCCTGGCCTGG - Intronic
911002466 1:93180473-93180495 CGCTCACGCCTGGCCTGAGGGGG - Exonic
912450568 1:109765273-109765295 AGGACGGGCCTGGCCTGAGCTGG - Intronic
912625806 1:111204070-111204092 CGGCGAGGCCAGGCCTGAGGGGG - Intronic
912827959 1:112923681-112923703 TGCTGTGGTCTGGCCTGAGCAGG - Intronic
914813084 1:151043726-151043748 CGGTGAGACCTGGGATGAGAGGG + Exonic
916660132 1:166915881-166915903 CCGTGAGGCCTGCCCTGTGTTGG + Exonic
917920482 1:179745441-179745463 GGGTGAGGACTGGACTGTGCTGG - Intronic
918001656 1:180502662-180502684 CTGTGAGGCCTGCTCTGCGCCGG + Exonic
920001996 1:202807239-202807261 CGGGGAGGCCTGGGCTGTGCTGG - Intronic
920285834 1:204878905-204878927 TGGAGAGGCCTGGCCAGAACTGG + Intronic
920364374 1:205440355-205440377 AGGTGGGGCCAGGCCTGAGGTGG - Intronic
923461666 1:234214351-234214373 CGGGGAGGCCGGGACTGAGAGGG + Intronic
923796824 1:237164761-237164783 CTTTGAGGTCTGGCCTGAACTGG - Intronic
924863481 1:247952222-247952244 CCGTGAGGCCAGTCCTGAGAAGG + Intronic
1066615024 10:37285231-37285253 CGGGGAGGCTTGGGCTGTGCAGG + Intronic
1067051306 10:43022905-43022927 CCATGAGGCCTGGCATGACCTGG - Intergenic
1067069157 10:43119772-43119794 GGGTGTGGCCTGGCCGGGGCTGG - Intronic
1067792803 10:49300673-49300695 CCATGTGGCCTGGGCTGAGCAGG + Intronic
1069677026 10:70255619-70255641 CTGGGAGGCCTGGCCCGAGAAGG - Exonic
1070255988 10:74813583-74813605 GGGTGAGGCCGGGCGGGAGCGGG + Intergenic
1072503587 10:96043373-96043395 CGGCGCGGCGTGGCCTGGGCTGG - Intronic
1072552307 10:96488305-96488327 CGGTAAGGGCTGCCCTGGGCTGG - Intronic
1072607555 10:96997468-96997490 GGGTAAGGCCAGGCCTGGGCAGG - Intergenic
1072611001 10:97017681-97017703 GGGTGAGGCCTGCCCAGAGGTGG - Intronic
1072660570 10:97361140-97361162 CAGTGATGACTGGCTTGAGCAGG - Intronic
1073290097 10:102409199-102409221 CGGCGCGGCCCGGCCCGAGCCGG + Intronic
1076837925 10:133030384-133030406 CGGTGGGACCAGGCCAGAGCCGG - Intergenic
1076923468 10:133467557-133467579 CGGAGAGGCCTGCCCTGTGGTGG + Intergenic
1076992770 11:284399-284421 AGGTGAGGCCTGGCCTGGGAGGG + Exonic
1077046737 11:550020-550042 TGGGGAGGCCTGGGCTGGGCCGG + Intronic
1077235453 11:1480034-1480056 CAGTGAGGGCTGGGCTGGGCAGG - Intronic
1077349312 11:2084949-2084971 AGGAGAGGCCTGACCTGAGGAGG + Intergenic
1077375122 11:2202163-2202185 CTCTGAGCCCTGGCATGAGCTGG - Intergenic
1077635814 11:3840873-3840895 AGGTGAGGCCCGGCCGGGGCTGG - Exonic
1079387739 11:19995903-19995925 GGGTGCTGCCTGTCCTGAGCAGG + Intronic
1083266129 11:61547675-61547697 GGATGAGGCCTGGGGTGAGCAGG + Intronic
1083934005 11:65860928-65860950 AGGTCAGGCCTGCCCTGACCAGG + Intronic
1084208981 11:67612244-67612266 CGGGGCCGCCTGGCCTGTGCAGG + Exonic
1084406571 11:68977651-68977673 AGGTGAGACCTGCTCTGAGCAGG + Intergenic
1085392344 11:76188940-76188962 GGGAGAGGCCAGGCCTGAGCCGG + Intronic
1085510731 11:77086803-77086825 TGGTGAGGCCTGGCGGGAGCAGG + Intronic
1089443111 11:118532178-118532200 TGGTCAGACCTGGGCTGAGCGGG + Exonic
1090788273 11:130069281-130069303 CGGAGAGGCCTGGGCGGAGCAGG + Intergenic
1094815523 12:34179782-34179804 CAGTGAAGCCTGGGCTGAGGAGG - Intergenic
1095940777 12:47725358-47725380 CTGTGTGGCCTGGCCTGGGCTGG - Exonic
1097270852 12:57772900-57772922 CGGTGAGGAATGGGCTGCGCCGG + Exonic
1101940774 12:109097810-109097832 CGGTGAGGCGCGGCTTGGGCCGG + Exonic
1103008409 12:117439511-117439533 GGGTGAGGCCTTGCCGGAGCTGG - Intronic
1103320957 12:120092661-120092683 CCGTGAGGCCTGGTCAGAGCAGG + Intronic
1103363876 12:120368950-120368972 CGGGGAGGCCCGGCCGGACCCGG + Intronic
1103815016 12:123647919-123647941 CGGTGAGGCCTGGTGTAACCAGG + Intronic
1106182633 13:27381754-27381776 CGGTGCGGCCTGGCCTGGCCTGG + Intergenic
1106907654 13:34425469-34425491 CGGTGAGGCCAGGACTGCTCTGG - Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1113389744 13:109883985-109884007 GGGTGAGGACGGGCCTGATCCGG - Intergenic
1113438835 13:110312944-110312966 CAGTGAGGGCTGGCCTGTGCAGG + Intronic
1113659439 13:112095559-112095581 CGGTGTAGCCTGTCCTGAGAGGG - Intergenic
1115788806 14:36856362-36856384 CGGTCAGGCCAGTCCTGATCTGG + Intronic
1117315858 14:54569498-54569520 CAGTGAGTCCTGGTGTGAGCTGG - Intronic
1118601405 14:67473304-67473326 GGCTGAGGCTTGGCCGGAGCAGG + Exonic
1118897344 14:69956054-69956076 TGGTGAGGCCAGGCCAGACCAGG + Intronic
1119788082 14:77327425-77327447 CTGGGTGGCCTGGCCTGAGTTGG - Intronic
1120778307 14:88461656-88461678 GGGTGAGGCATCGCCTCAGCCGG - Intronic
1121562967 14:94887851-94887873 GGGAGAGGCCTGGCCTCACCAGG - Intergenic
1121720534 14:96105675-96105697 CGGTGAGGAATGGCCTGATCTGG + Intergenic
1122411207 14:101527060-101527082 CGGGGCAGCCTGGCCTCAGCAGG + Intergenic
1122514573 14:102297986-102298008 CGGGGAGGCTTGGGCTGCGCAGG - Intronic
1122890512 14:104730049-104730071 AGGTGAGGGGTGGGCTGAGCTGG - Exonic
1123010137 14:105345908-105345930 CGGAAGGGCCTGGCCTGAGGGGG - Intronic
1123016357 14:105377398-105377420 TGGGGTGGCCTGGCCTGGGCAGG + Intronic
1125680764 15:41528845-41528867 AGGCAAGGCATGGCCTGAGCTGG + Intronic
1125730442 15:41890030-41890052 AGGTGAGGCCAGGGCTGGGCTGG + Intronic
1127396503 15:58547690-58547712 GGGTGAGGCCTGTCCAGATCTGG + Intronic
1128304367 15:66588463-66588485 CCATGAGGCCTGTCCAGAGCGGG + Intronic
1129325846 15:74799971-74799993 AGGTGTGGCCTGGCCAGGGCTGG - Intronic
1129608155 15:77034874-77034896 GGCTTAGGCCTGGACTGAGCTGG - Intronic
1129927897 15:79382526-79382548 CAGTGATGCCTGGCCTGCACTGG + Intronic
1131158738 15:90090811-90090833 CAGTGGGGCCTGGCCAGAGCTGG + Intronic
1132871264 16:2116746-2116768 CGGTGGAGCCTGGGCTGAGGAGG - Intronic
1133102129 16:3486002-3486024 CGGCGATGCCTGTCCTCAGCAGG - Exonic
1133103182 16:3491406-3491428 CGCTGAGCCCTAGCCTGACCCGG + Intergenic
1134521262 16:14920148-14920170 CGGTGGAGCCTGGGCTGAGGAGG + Intronic
1134708937 16:16318799-16318821 CGGTGGAGCCTGGGCTGAGGAGG + Intergenic
1134716147 16:16358833-16358855 CGGTGGAGCCTGGGCTGAGGAGG + Intergenic
1134742707 16:16561911-16561933 CTCTAAGGCCTGGCCTGAGGAGG + Intergenic
1134924851 16:18150553-18150575 CTCTAAGGCCTGGCCTGAGGAGG - Intergenic
1134950668 16:18349846-18349868 CGGTGGAGCCTGGGCTGAGGAGG - Intergenic
1134958606 16:18393326-18393348 CGGTGGAGCCTGGGCTGAGGAGG - Intergenic
1137704397 16:50524217-50524239 TGGTGAGGACTGACCTGTGCAGG + Intergenic
1137770374 16:51011721-51011743 TGGAGAGGCCTGGCGTGATCAGG - Intergenic
1139914075 16:70417511-70417533 AGCAGAGGCCTGACCTGAGCTGG + Intronic
1140457537 16:75113895-75113917 AGGTGAGGCCTGGCCTTCCCAGG + Intronic
1141552489 16:84815532-84815554 TGGTGAGGCACAGCCTGAGCTGG + Intergenic
1142211625 16:88811313-88811335 CGGTCACGCCTGTCCTGGGCTGG + Intronic
1142291514 16:89195536-89195558 CAGTGAGGCCTGGCCTGGCAGGG + Intergenic
1142482460 17:227401-227423 TGGAGAGGCCTGGCCTGGGATGG + Intronic
1143422788 17:6808414-6808436 CGGTGAGGCATTGCCTCACCCGG - Intronic
1143461458 17:7107059-7107081 CGGGAAGGCCTGGGCTGAGGCGG - Exonic
1143886635 17:10069922-10069944 GGGTGAGGGCAGGCCTCAGCAGG - Intronic
1143992742 17:10980426-10980448 CTGTTAGGCCTGGCCTGATGAGG + Intergenic
1145280262 17:21462897-21462919 TGGAGAGGCCTGGCCTAATCAGG - Intergenic
1145908778 17:28530885-28530907 CAGAGAGGCCTGGCCTGTCCAGG - Intronic
1147659951 17:42112092-42112114 AGGTGAGTCCTGGGCTGGGCAGG - Exonic
1147884480 17:43675581-43675603 CGGACAGGGCTGGCCTGGGCAGG + Intergenic
1149581605 17:57754534-57754556 CAGTCAGGCCTGGCCAGGGCAGG + Intergenic
1150832630 17:68537629-68537651 CAGTGAGGACAGGGCTGAGCTGG + Exonic
1151385073 17:73750206-73750228 TGGCCTGGCCTGGCCTGAGCAGG + Intergenic
1151674960 17:75592566-75592588 CGGGGAGGCCTGCCCAGAGGAGG + Intergenic
1152105784 17:78328058-78328080 CAGTGAGGCCTGGGCTGTGAAGG - Intergenic
1152133752 17:78492274-78492296 CGGGGAGCCCTGGCCTCAGTCGG - Intronic
1152537239 17:80957817-80957839 CGGTGAGGCCTGGCCATCCCAGG + Intronic
1152574411 17:81133780-81133802 GGGTGAGGCCTGGCCTCACTAGG - Intronic
1152754634 17:82082132-82082154 CCGAGAGGCGTGCCCTGAGCTGG - Exonic
1155568536 18:27163761-27163783 GGGTGAGGCATGGCCTCACCCGG - Intronic
1158492148 18:57919779-57919801 TGATGAGGCTTTGCCTGAGCTGG + Intergenic
1159627752 18:70714479-70714501 GGGTGAGGCGTAGCCTCAGCTGG + Intergenic
1160392850 18:78548048-78548070 GGGAGAGGCCTGGGCAGAGCTGG - Intergenic
1160702934 19:517356-517378 CGGGGAGGAGAGGCCTGAGCTGG + Intronic
1160823737 19:1069738-1069760 CTTGGAGGCCTGGCCTGGGCGGG + Intronic
1161013263 19:1970214-1970236 CGGCGTGGCCTGGCCTGCTCTGG - Intronic
1161059701 19:2208737-2208759 GGGTGACGCCTGGCCACAGCTGG + Intronic
1161221194 19:3119052-3119074 AGGTGGGCCCTGCCCTGAGCAGG + Exonic
1161818499 19:6515245-6515267 CCATGAGGCCTGGTCTGAGTGGG - Intergenic
1161977644 19:7615321-7615343 AGGTGAGGCCGGGCCTGCCCGGG + Exonic
1162962507 19:14136327-14136349 CGGTGAGGCTGGGCCTGTGCGGG - Exonic
1163129856 19:15265532-15265554 GGGTGAGGCGTGGCCTGCACAGG + Exonic
1163158095 19:15449777-15449799 CGGTGAGGCCCGGCCCGGCCTGG - Exonic
1163329671 19:16628291-16628313 CGGAGACGCCAGGCCTGGGCGGG + Intronic
1163482726 19:17567561-17567583 CTGTGGGGACTGGGCTGAGCAGG + Intronic
1163758454 19:19120494-19120516 TGGTGAGGCAGGGTCTGAGCAGG - Intronic
1165309873 19:35023401-35023423 TGGGGATGCCAGGCCTGAGCAGG - Intronic
1165329715 19:35134723-35134745 CGTAGTGGCCTGGGCTGAGCTGG - Exonic
1165472845 19:36013493-36013515 AGGTGAGGCCTGGCCTGTGATGG - Intronic
1165767845 19:38361999-38362021 GGGCGGGGCCTGGCTTGAGCAGG + Intronic
1166381264 19:42356452-42356474 AGGTGAGGACTGCCCTGGGCAGG + Exonic
925030651 2:648046-648068 GCCTGAGGCCTGGGCTGAGCTGG - Intergenic
925113025 2:1352430-1352452 CAGTGAGGCTGGGCCTGTGCAGG + Intronic
926055040 2:9769485-9769507 CTCTGAGTCTTGGCCTGAGCAGG + Intergenic
927516617 2:23675316-23675338 GGGTGGGTCCTGGGCTGAGCAGG - Intronic
929386598 2:41415034-41415056 TGGTTAGGCCAGGCCTGAGCAGG - Intergenic
929536627 2:42788097-42788119 GGGTGAGGGCTGGGCTGAGTGGG - Intronic
929561570 2:42959641-42959663 GGGAGAGGCCTTGGCTGAGCAGG + Intergenic
933840791 2:86284210-86284232 CGGGGAGGCCTTTCCTGACCTGG + Intronic
934056353 2:88254382-88254404 GGGTGAGGCCTGGGCTGACAAGG + Intergenic
934790952 2:97059739-97059761 CTGTCAGGCCTGGTCTGACCTGG + Intergenic
934815497 2:97322791-97322813 CTGTCAGGCCTGGTCTGACCTGG - Intergenic
934822198 2:97385692-97385714 CTGTCAGGCCTGGTCTGACCTGG + Intergenic
935062939 2:99623747-99623769 CTGTGAGCCCTGTCCTGACCTGG + Intronic
935663107 2:105486935-105486957 TGGTGAGGACTGGGGTGAGCTGG - Intergenic
936512239 2:113157547-113157569 CGGGGAGGCCTGGGCCGGGCGGG + Intronic
937915978 2:127098928-127098950 TGGTGGGGCCTAACCTGAGCTGG - Intronic
938379141 2:130826933-130826955 CTCTGAGGCCTGGCCAGAGCTGG - Intergenic
940261782 2:151788259-151788281 CTGGGAGGCCTGGCCTGATCTGG - Intergenic
945943414 2:215972012-215972034 GGGTGATCCCTGGCATGAGCTGG - Intronic
946284554 2:218693281-218693303 AGATGAGGGATGGCCTGAGCTGG - Exonic
947815722 2:233034865-233034887 CCCTGAGGCCTGGTCAGAGCCGG + Exonic
948213823 2:236214428-236214450 CGGTGAGGCCTGGAGAGCGCAGG + Exonic
948860346 2:240749905-240749927 CAGGGAGGGCTGCCCTGAGCAGG + Intronic
948902844 2:240964987-240965009 AGGGGAGGCCTGGCCTCTGCAGG + Intronic
1171374632 20:24684006-24684028 CGGAGAGCCCTGTGCTGAGCCGG - Intergenic
1171413484 20:24961978-24962000 ACATGAGGCCTGGCCAGAGCTGG + Intergenic
1172429351 20:34876822-34876844 GGGTGAGGCCCGGCCCGGGCGGG + Exonic
1172446986 20:34998420-34998442 CGGTGAGGCTGGGGCTCAGCTGG + Exonic
1174039706 20:47690208-47690230 CCATGAGGACTGGCCTGTGCGGG + Exonic
1175442072 20:58999391-58999413 TGGAGGGGCCTGGCCTCAGCTGG + Intronic
1176343062 21:5716022-5716044 AGGTGAGGCCTGGCCTGGATAGG - Intergenic
1176475316 21:7148173-7148195 AGGTGAGGCCTGGCCTGGATAGG - Intergenic
1176501765 21:7608434-7608456 AGGTGAGGCCTGGCCTGGATAGG + Intergenic
1176537383 21:8114091-8114113 AGGTGAGGCCTGGCCTGGATAGG - Intergenic
1178965085 21:37109255-37109277 GGGTGAGGCATGGCCTCACCGGG + Intronic
1179242138 21:39601931-39601953 TGGTGAGGCCTGGGCTGGGGTGG + Intronic
1179635025 21:42703343-42703365 AGGAGGGGCCAGGCCTGAGCCGG + Intronic
1179884913 21:44309764-44309786 CAGGCTGGCCTGGCCTGAGCCGG + Intronic
1180159914 21:45994389-45994411 GGGTGAGGCGCGGCCTGGGCCGG + Intronic
1180222364 21:46367161-46367183 AGGAGAGGCCTGCCCTGGGCTGG - Intronic
1181028910 22:20140707-20140729 CGGTGAGGCCCGGCCTGGGCAGG + Exonic
1181118061 22:20646385-20646407 TGGTGAGGCTTGGCCTGCTCTGG - Intergenic
1181164259 22:20974919-20974941 CGGACAGGCCTGGCATAAGCAGG - Intronic
1181310583 22:21942611-21942633 AGCTGAGGCCTGGCCTCACCGGG - Intronic
1181419267 22:22786467-22786489 CGGTGGGGCCTGGCCTGGTAGGG + Intronic
1181440417 22:22932755-22932777 CCCCGAGGCCTGGCCTGTGCAGG + Intergenic
1181456680 22:23063881-23063903 AGGTGAGGCCTGGCCTAGGCTGG - Exonic
1181669829 22:24420862-24420884 GGTGGGGGCCTGGCCTGAGCCGG + Intronic
1183472513 22:38017073-38017095 CTGTGGGGCCGTGCCTGAGCGGG + Intronic
1184604639 22:45565288-45565310 ATGGGAGGCCTGGCCTGATCTGG + Intronic
1184785451 22:46669400-46669422 CGGTGAGGACCGGGCTGTGCCGG + Intronic
1184821235 22:46910565-46910587 CAGTTGGGCCTGGCCTTAGCTGG + Intronic
1184877286 22:47283812-47283834 GAGTGATGCCTGGCCTGTGCGGG + Intergenic
1185272221 22:49934852-49934874 GGGAGTGGCCTGGCCTGAGGAGG + Intergenic
1185414360 22:50701661-50701683 TGATGAGGCTTGGCCTGAGCTGG + Intergenic
1203242327 22_KI270733v1_random:30447-30469 AGGTGAGGCCTGGCCTGGATAGG - Intergenic
950282356 3:11719353-11719375 GGGCGAGGGCTGGCCTGAGAGGG - Intronic
950767748 3:15286100-15286122 CGGCGGGCCCTGGCCAGAGCAGG + Intronic
951415484 3:22417248-22417270 CAGGGAGGCTTGGGCTGAGCAGG - Intergenic
952252924 3:31671993-31672015 GAGTGAGGCCTGGGGTGAGCTGG - Intronic
953530463 3:43735773-43735795 AGCTGTGGCCTGCCCTGAGCTGG + Intergenic
954895610 3:53972615-53972637 CCGTGAGGCCCTGCCTGATCTGG + Intergenic
956592197 3:70926623-70926645 GTGTGAGGCCTGGCCTTAACTGG - Intergenic
956632639 3:71331395-71331417 CGGGGAGGCTTGGGCTGCGCAGG - Intronic
961370309 3:126424556-126424578 TGGTGAGGCATGTCCAGAGCAGG + Intronic
961537105 3:127576941-127576963 CAGGGAGGCCTGGCCTGGGGTGG - Intronic
961574526 3:127823428-127823450 CAGGGAGGCCTGAACTGAGCTGG + Intergenic
961650722 3:128415554-128415576 TGGGGAGGCCTGGCCAGTGCGGG - Intergenic
961684234 3:128618239-128618261 CGCCGAGCTCTGGCCTGAGCCGG - Intergenic
962809193 3:138946991-138947013 AGGCGGGGACTGGCCTGAGCGGG - Exonic
964200314 3:154111603-154111625 CTGTGAAGCCTGGGCTGAGGTGG - Intergenic
964498547 3:157322612-157322634 CTGTGAGGGCTGTCCAGAGCAGG + Intronic
965901290 3:173644814-173644836 GGCTGAGGCCTGGCCAGGGCAGG - Intronic
966774999 3:183536118-183536140 CGGTCAGACATGGGCTGAGCTGG - Intronic
967724685 3:192850571-192850593 GGGTGGGGCCTGGCCTGTGCAGG - Intronic
968045611 3:195622504-195622526 TGTTGAGGCCTGGCCTGGCCTGG + Intergenic
968045625 3:195622543-195622565 CGTTGAGGCCTGGCCTGGACTGG + Intergenic
968045638 3:195622582-195622604 CGTTGAGGCCTGGCCTGGCCTGG + Intergenic
968045652 3:195622621-195622643 TGTTGAGGCCTGGCCTGGCCTGG + Intergenic
968045667 3:195622660-195622682 TGTTGAGGCCTGGCCTGGCCTGG + Intergenic
968064364 3:195750386-195750408 TGTTGAGGCCTGGCCTGGCCTGG + Intronic
968064379 3:195750425-195750447 TGTTGAGGCCTGGCCTGGCCTGG + Intronic
968081573 3:195849918-195849940 CGCTGAGGCCGGGGCTGCGCTGG - Intergenic
968091472 3:195900878-195900900 GGGTGGGGTATGGCCTGAGCTGG - Intronic
968308989 3:197667427-197667449 TGTTGAGGCCTGGCCTGGCCTGG - Intergenic
968309003 3:197667466-197667488 TGTTGAGGCCTGGCCTGGCCTGG - Intergenic
968733786 4:2284811-2284833 CGCTGTGGCCTGAGCTGAGCTGG - Intronic
969695919 4:8734820-8734842 TGGAGAGGCCTGGCCTGGCCAGG + Intergenic
972416651 4:38847478-38847500 CGGTGAGGCATTGCCTCACCCGG + Intronic
975620407 4:76290883-76290905 GGGTGAGGCCTTGCCTCACCCGG - Intronic
978351666 4:107825679-107825701 CGGTGTGGGCTGCCCAGAGCTGG - Intronic
979392463 4:120142836-120142858 AGGTGAGGCCTGGCCTTGGAGGG - Intergenic
982299034 4:153860010-153860032 GGGTGAGGCATTGCCTAAGCCGG - Intergenic
983216381 4:165006734-165006756 TGCGGAGGCCTGGCCTGACCTGG - Intergenic
985615967 5:922265-922287 CTCTGTGGCCTGGCCTGAGAGGG - Intergenic
985647538 5:1092048-1092070 GGGTGGGGCCTGGCCTGATGAGG - Intronic
985809845 5:2074905-2074927 GGGTGAGGGGTGGCCTGGGCAGG + Intergenic
986963632 5:13244484-13244506 CGGGGAGGCTTGGGCTGTGCAGG - Intergenic
987133832 5:14882797-14882819 GGGTGTGGCCAGACCTGAGCTGG + Intergenic
992865110 5:80950266-80950288 CATGGAGGTCTGGCCTGAGCAGG - Intergenic
993454379 5:88110569-88110591 CAGAAAGGTCTGGCCTGAGCTGG + Intergenic
995027253 5:107438507-107438529 AGCTGAGGCCTGACCTGAGCAGG - Intronic
995784105 5:115809910-115809932 TGGTGAGGCCTGGTATGAACTGG - Intronic
996119283 5:119652696-119652718 CGCTGAGGCCTGGGCTCACCTGG - Intergenic
997718782 5:136061915-136061937 TGGCCAGGCCTGCCCTGAGCCGG + Intronic
999254307 5:150201250-150201272 GGGAGGGGCCAGGCCTGAGCTGG + Intronic
1001083193 5:168681784-168681806 AGCTGAGCCCTGCCCTGAGCTGG - Intronic
1001264929 5:170267356-170267378 CTGCGAGGCCCTGCCTGAGCTGG + Intronic
1001380721 5:171304792-171304814 CGGTGAGGGCTGGCCATAGTGGG - Intergenic
1002211145 5:177600105-177600127 CGGACAGGCCTGGGCGGAGCGGG + Exonic
1002599885 5:180348059-180348081 GGGTGAGTCCTGGCCTGGGTGGG - Intronic
1002643341 5:180640893-180640915 GGGTGAGCGCTGGCCTTAGCTGG + Intronic
1003498798 6:6687219-6687241 GGGTGAGGCCTGGAGTGGGCGGG - Intergenic
1003694764 6:8392849-8392871 TGGAGAGGGCTGGCCTGAGGAGG - Intergenic
1004053109 6:12108451-12108473 CGGGGAGGCTTGGGCTGCGCAGG + Intronic
1004354115 6:14916279-14916301 CGGGGAGGCTTGGACTGTGCAGG - Intergenic
1005912879 6:30326556-30326578 CGGCGGCGCCTGGCCAGAGCCGG + Intronic
1006591368 6:35160451-35160473 CGTGGAGGCTTGGCCTGTGCAGG + Intergenic
1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG + Intronic
1007637641 6:43308729-43308751 CGGTGAGGCCCGGGCTGCGGAGG - Exonic
1007686613 6:43670841-43670863 AGGTGAGGCCCGGCCAGAGCAGG - Exonic
1013954973 6:115831325-115831347 CGATGAGGTCTGGCAGGAGCTGG - Intergenic
1018844535 6:167546692-167546714 AGGTAAGGGCTGGCCTGACCAGG - Intergenic
1019112215 6:169724861-169724883 CGGGGAAGCGTGGCCTGGGCAGG - Intronic
1019340974 7:508799-508821 CTGTGAGGCCTGGCTGGGGCTGG - Intronic
1019364777 7:627721-627743 CGGGGAGGGCGGGCGTGAGCTGG - Intronic
1019413049 7:914909-914931 GGGTGAGCCCTGCCCTGAGCAGG + Intronic
1019674134 7:2301242-2301264 CAGTGTGGCCTGGCCTGTGAGGG - Intronic
1021359370 7:19692312-19692334 TGGGGAGGCTTGGCCTGAGTGGG + Intergenic
1022226781 7:28371534-28371556 TGGGGAGGCCAGGCCTGAGCTGG + Intronic
1022508604 7:30921782-30921804 TGGAGAGGCCTGGGGTGAGCTGG - Intronic
1023867041 7:44243229-44243251 TGGTGAGGCCTGGCCTGAGTTGG - Exonic
1024295305 7:47836989-47837011 CGGTGAGGCGCGGCGTGTGCAGG + Exonic
1025141755 7:56472439-56472461 AGGTGAGGCCTGGCCTGGATGGG + Intergenic
1025724113 7:64042285-64042307 CAGTGAGGTTTGGCCTGAGCTGG + Intronic
1025724292 7:64043442-64043464 CAGTGAGGTTTGGCCTGAGCTGG - Intronic
1025753234 7:64311547-64311569 CAGTGAGGTTTTGCCTGAGCTGG + Intronic
1026642874 7:72142166-72142188 GGGTGAGGCATCGCCTGACCTGG + Intronic
1028774144 7:94658448-94658470 TGGAGAGGCGGGGCCTGAGCAGG - Intronic
1028931277 7:96415506-96415528 GTGGGAGGCCTGGGCTGAGCAGG + Intergenic
1029849386 7:103446252-103446274 CGGCGGGGCCTGGCCCTAGCGGG - Intergenic
1033547299 7:142413139-142413161 CAGGTAGGGCTGGCCTGAGCTGG - Intergenic
1033742315 7:144284601-144284623 CGGTGCTGCCTGGCCACAGCGGG + Intergenic
1033751587 7:144365013-144365035 CGGTGCTGCCTGGCCACAGCGGG - Exonic
1033758577 7:144418031-144418053 CGGGGAGGCTTGGGCTGTGCAGG + Intergenic
1034185888 7:149176618-149176640 CAGTCAGTCCTGGCATGAGCTGG - Intronic
1034421983 7:150995359-150995381 GGGTAAGGCCTGGCCTCAGATGG + Intronic
1035665769 8:1378593-1378615 AGGTGAGGCCAGGTGTGAGCAGG - Intergenic
1037818727 8:22125395-22125417 TGGCGAGGCCTGTGCTGAGCCGG + Exonic
1037943887 8:22974492-22974514 GGCAGAGGCCTGGCCTGCGCTGG - Intronic
1038411069 8:27360404-27360426 AGAGGAGGCCTGGCCTGGGCAGG + Intronic
1040364877 8:46705179-46705201 GGGTGAGGCATGGCCTCACCCGG - Intergenic
1044731338 8:95230949-95230971 TGGAGAGGCCTGGACTGGGCAGG + Intergenic
1046618456 8:116502357-116502379 GTGTGAAGCCTGGCCTGAGCAGG - Intergenic
1047182986 8:122606785-122606807 CGGTGAGCCTTTGCCTGATCTGG - Intergenic
1047874669 8:129122847-129122869 TTGTGATCCCTGGCCTGAGCAGG - Intergenic
1049191402 8:141289804-141289826 TGGTGAGGCCTTGCCTTACCTGG - Intronic
1049382648 8:142325138-142325160 CGGCAAGGCCTGGACTGAGCGGG + Intronic
1049694802 8:143977886-143977908 CGGTGAGGCCTGAGCCGGGCAGG - Exonic
1053437077 9:38083001-38083023 GGGAGATGCCTGCCCTGAGCAGG + Intergenic
1054905991 9:70413911-70413933 CGGTGCGGACCGGCCGGAGCAGG - Exonic
1057443376 9:95097570-95097592 TGATGAGGCCTGGTGTGAGCCGG - Intergenic
1059621344 9:116008862-116008884 CTGTGTGGGCTGGCCAGAGCAGG - Intergenic
1060188105 9:121576054-121576076 AGGTGAGGCCTGGCCTGAAGTGG - Intronic
1060206504 9:121685536-121685558 GAGAGAGGCCTGGCCTCAGCAGG + Intronic
1060263024 9:122092666-122092688 AGGTGAGGCCCGGCCCGACCCGG - Exonic
1060818600 9:126648907-126648929 CCGTGCGGCATGGCCTGATCCGG - Intronic
1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG + Exonic
1061227577 9:129289597-129289619 GGGTGAGGCCGGCACTGAGCAGG + Intergenic
1061343445 9:130002467-130002489 CTATGAGTCCTGGCCAGAGCTGG + Intronic
1061874817 9:133538423-133538445 AGGTGAGGCCCGGCCCGGGCAGG + Exonic
1061944060 9:133898714-133898736 TCATGAGGCCAGGCCTGAGCTGG + Intronic
1062394789 9:136348408-136348430 GGGAGAGGCCTGTCCAGAGCCGG + Intronic
1062676144 9:137745566-137745588 CGGGGAGGGCTGGGCTGTGCTGG - Intronic
1203458655 Un_GL000220v1:13524-13546 AGGTGAGGCCTGGCCTGGATAGG - Intergenic
1185641523 X:1591675-1591697 CGGTGAGGCCGCGCCTGTCCGGG + Exonic
1186747343 X:12583556-12583578 CGGTTAGGCCTGGCTTGCGCTGG - Intronic
1187007650 X:15248140-15248162 CTTTGAGGCCTGGGCTGGGCTGG - Intronic
1190781875 X:53604658-53604680 AGGTGTGGCCTGGGCTGAGAGGG + Exonic
1196824605 X:119731360-119731382 CAGGGAGGCCTTCCCTGAGCAGG + Intergenic
1200231618 X:154446559-154446581 AGGTGAGGGCTGGCTTGAGTCGG + Exonic