ID: 1060826870

View in Genome Browser
Species Human (GRCh38)
Location 9:126692814-126692836
Sequence GTGTGTGCATGCCTGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060826868_1060826870 4 Left 1060826868 9:126692787-126692809 CCTGAAAGTGTGTGCAGCCACAT 0: 1
1: 0
2: 1
3: 15
4: 165
Right 1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG No data
1060826866_1060826870 12 Left 1060826866 9:126692779-126692801 CCTGCCTTCCTGAAAGTGTGTGC 0: 1
1: 0
2: 0
3: 20
4: 202
Right 1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG No data
1060826865_1060826870 21 Left 1060826865 9:126692770-126692792 CCGAGTGGGCCTGCCTTCCTGAA 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG No data
1060826862_1060826870 29 Left 1060826862 9:126692762-126692784 CCTGTTCCCCGAGTGGGCCTGCC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG No data
1060826863_1060826870 23 Left 1060826863 9:126692768-126692790 CCCCGAGTGGGCCTGCCTTCCTG 0: 1
1: 0
2: 0
3: 19
4: 179
Right 1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG No data
1060826867_1060826870 8 Left 1060826867 9:126692783-126692805 CCTTCCTGAAAGTGTGTGCAGCC 0: 1
1: 0
2: 1
3: 13
4: 152
Right 1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG No data
1060826864_1060826870 22 Left 1060826864 9:126692769-126692791 CCCGAGTGGGCCTGCCTTCCTGA 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060826870 Original CRISPR GTGTGTGCATGCCTGTGCTG TGG Intronic
No off target data available for this crispr