ID: 1060826987

View in Genome Browser
Species Human (GRCh38)
Location 9:126693257-126693279
Sequence CTCTTCGCTGCTGCGTGGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060826987_1060826990 -2 Left 1060826987 9:126693257-126693279 CCTCACCACGCAGCAGCGAAGAG 0: 1
1: 0
2: 2
3: 7
4: 116
Right 1060826990 9:126693278-126693300 AGCCTTCAAGGCCTCCTTCGAGG 0: 1
1: 0
2: 0
3: 5
4: 97
1060826987_1060826997 29 Left 1060826987 9:126693257-126693279 CCTCACCACGCAGCAGCGAAGAG 0: 1
1: 0
2: 2
3: 7
4: 116
Right 1060826997 9:126693309-126693331 AAGCCTTGCCGAAAGGTGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 109
1060826987_1060826996 28 Left 1060826987 9:126693257-126693279 CCTCACCACGCAGCAGCGAAGAG 0: 1
1: 0
2: 2
3: 7
4: 116
Right 1060826996 9:126693308-126693330 GAAGCCTTGCCGAAAGGTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1060826987_1060826995 27 Left 1060826987 9:126693257-126693279 CCTCACCACGCAGCAGCGAAGAG 0: 1
1: 0
2: 2
3: 7
4: 116
Right 1060826995 9:126693307-126693329 CGAAGCCTTGCCGAAAGGTGAGG 0: 1
1: 0
2: 0
3: 0
4: 43
1060826987_1060826994 22 Left 1060826987 9:126693257-126693279 CCTCACCACGCAGCAGCGAAGAG 0: 1
1: 0
2: 2
3: 7
4: 116
Right 1060826994 9:126693302-126693324 CTCGTCGAAGCCTTGCCGAAAGG 0: 1
1: 0
2: 0
3: 0
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060826987 Original CRISPR CTCTTCGCTGCTGCGTGGTG AGG (reversed) Exonic
900458585 1:2789498-2789520 CTCACCCCTCCTGCGTGGTGGGG + Exonic
900573272 1:3370525-3370547 CTCTCCTCTGGTGGGTGGTGGGG - Intronic
903214692 1:21837236-21837258 CTCCTCGCTTCTGGGTGGGGAGG + Intronic
904378259 1:30095201-30095223 CTCCTGGCTGCTGAGTGGTAGGG + Intergenic
907307598 1:53521957-53521979 CTCTCAGCTGCTGTGTGATGTGG - Intronic
924592643 1:245418190-245418212 TCCTTTGCTGCTGTGTGGTGCGG - Intronic
1069692824 10:70364914-70364936 CTGATGGCTGCTGCGGGGTGGGG - Intronic
1071511290 10:86264164-86264186 CTCTTAGCTCCAGCGTGGGGTGG - Intronic
1071578427 10:86747687-86747709 CTCTTTGCTGCTTCTTGGGGTGG - Intergenic
1073424725 10:103449563-103449585 CATCTCCCTGCTGCGTGGTGAGG - Exonic
1075206475 10:120453676-120453698 CTGTTCCATGCTGCATGGTGGGG - Intergenic
1076646168 10:131956356-131956378 GCCTTCACTGCAGCGTGGTGTGG + Exonic
1080685174 11:34509465-34509487 CTCTTTGCTGATGCCTGGAGAGG + Intronic
1082100559 11:48169778-48169800 CTCTTCCCTTCCGCCTGGTGTGG + Intronic
1085392012 11:76187031-76187053 GTCCTCGCTCCTGCGTGGGGCGG + Exonic
1090472211 11:126990398-126990420 CTCCTCGCCTCTGGGTGGTGAGG - Intronic
1091021673 11:132105579-132105601 CGCTTCTCTGCTGCCTGCTGGGG - Intronic
1096083584 12:48849856-48849878 CCCTTCGCTCCTGCCTGGGGAGG + Intronic
1100878700 12:98992520-98992542 CTCTGTGCTGCTGCCTTGTGAGG + Intronic
1101961231 12:109251977-109251999 CTCTTCCCTGCTGTGGGGGGTGG + Intronic
1104791218 12:131483304-131483326 CTCTCAGCTGCTGCGTGTTGTGG + Intergenic
1106468311 13:30032719-30032741 CTCTTCTCTGCTGGCAGGTGGGG - Intergenic
1107376828 13:39812558-39812580 CTCTCCTCTGCTGCTTTGTGGGG + Intergenic
1111929915 13:94502535-94502557 CTCCTCGCAGCTGAGTGTTGAGG - Intergenic
1112089928 13:96072455-96072477 CTCTTCCTTGCTGCTGGGTGGGG + Intergenic
1113627110 13:111855475-111855497 CCCTTCGCAGCTGTGTGATGCGG - Intergenic
1119205491 14:72790892-72790914 CTTTTCCCTGCTGGGTGCTGCGG + Intronic
1122930636 14:104931666-104931688 CTCTTAGGTGGTGCATGGTGGGG + Intronic
1124026753 15:25973953-25973975 CTATACCCGGCTGCGTGGTGTGG + Intergenic
1124251121 15:28106996-28107018 CGCTTCGCTGCCGCGCGGGGAGG + Intergenic
1126200990 15:45985911-45985933 CTCTTTGCTGCTGCCATGTGAGG + Intergenic
1128236431 15:66070684-66070706 CTCCCCGCTGCTGCGGGGTGGGG - Intronic
1130883380 15:88073783-88073805 CTCTTCCCTGCGGGGTGGGGCGG - Intronic
1132326863 15:100977688-100977710 CCCTTCATTGCTGCCTGGTGGGG - Intronic
1135608027 16:23839619-23839641 CTCTACGCTGCCTCTTGGTGGGG - Intronic
1137011286 16:35322904-35322926 CTATTCACTGCTTCTTGGTGTGG + Intergenic
1137029945 16:35513057-35513079 CTGTCCGCTGCTGCTTGGTGTGG + Intergenic
1137578846 16:49621376-49621398 CTCCTGGCTGCTGCTTGGAGGGG - Intronic
1141146705 16:81536004-81536026 CTCTTGTCTGCTGTGTGCTGTGG + Intronic
1142413151 16:89926243-89926265 CTCCTCGCGGCTGCGGGGCGGGG + Intronic
1142642555 17:1292878-1292900 CTCCGCGCTGCTGCGTCCTGGGG + Intronic
1143053531 17:4145468-4145490 CGCTGCCCTGCTGCGTGCTGTGG + Intronic
1143295357 17:5867308-5867330 CTCTTGGCTGCAGCCTGGGGAGG + Intronic
1143758650 17:9085159-9085181 CACTTCGTGGCTGGGTGGTGGGG + Intronic
1144044114 17:11439421-11439443 CTCTTCACTGCTGCATGCTAAGG - Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1144956086 17:19019637-19019659 CTCTTCCCTGCTGCCTGTGGGGG + Intronic
1146631003 17:34469259-34469281 CTCTTCATTGCTGAGTGTTGTGG + Intergenic
1147158665 17:38558535-38558557 CCCTTCGCTGCTGCCTGAGGCGG - Intronic
1149274406 17:55017424-55017446 CTCTACGCTGCTGCGTCCTTAGG - Intronic
1157389037 18:47285703-47285725 CTCTTTCCTGCTGCCTTGTGAGG + Intergenic
1157586881 18:48806663-48806685 GTTTGCGCTGCTGGGTGGTGTGG + Intronic
1158665824 18:59431667-59431689 CTCTTCGCTGGTATTTGGTGGGG + Exonic
1159793714 18:72816596-72816618 CTCCTTGCTGCTGCCTGGAGAGG - Intronic
1161037787 19:2095360-2095382 CTCTTCGCTGCAGGGAGGAGGGG + Intronic
1161300254 19:3539056-3539078 CTCCTCCCAGCTGCGGGGTGAGG - Intronic
1163382932 19:16980554-16980576 TGCTTCGCTGCTGGGTGGTGTGG + Exonic
1164836061 19:31355846-31355868 TTCCTCGCTGCAGCGTGGCGTGG + Intergenic
926076943 2:9950325-9950347 TTCTCTGCTGCTGCGTGGTGGGG - Intergenic
929472206 2:42205548-42205570 CTCTTAGAAGCTGTGTGGTGTGG + Intronic
933042214 2:77483626-77483648 CTCTTCCCTGCTGGGTGCGGTGG - Intronic
934475748 2:94592267-94592289 CTTTTTGCTGCTGCGAGGTCAGG - Intronic
936889852 2:117356510-117356532 CTCTTGGCTTCTGGCTGGTGGGG - Intergenic
937937834 2:127260215-127260237 GTCTTCGGTGCTGCCTGTTGAGG - Intronic
946008230 2:216543508-216543530 CTCTTCGCTATTGCCTGGTTTGG - Intronic
948282859 2:236761568-236761590 CTCTTTACTGCTGAGTAGTGTGG + Intergenic
948583818 2:239005815-239005837 CCCTTCTCTGCTGCGGGGTTGGG + Intergenic
1168878126 20:1185160-1185182 CCCTTCGCCCCAGCGTGGTGAGG - Intronic
1171021677 20:21589817-21589839 CTATTGGCTGCTGTGTAGTGTGG + Intergenic
1171206613 20:23286616-23286638 CTCAACGCTGCTCCCTGGTGCGG - Intergenic
1174267087 20:49339859-49339881 CTCTTAGCCACTCCGTGGTGTGG + Intergenic
1176122828 20:63461802-63461824 CTCTTCCCTGCTCCCTGGGGTGG - Intronic
1176122915 20:63462074-63462096 CTCTTCCCTGCTCCCTGGGGTGG - Intronic
1176122925 20:63462104-63462126 CTCTTCCCTGCTCCCTGGGGTGG - Intronic
1177451148 21:21268346-21268368 TTCTTGGCTCCTGTGTGGTGTGG - Intronic
1179658805 21:42861952-42861974 TTGTTCGCTGGTGGGTGGTGGGG - Intronic
1183752816 22:39731765-39731787 CTCTTACCTGCTGCTTGGCGGGG - Intergenic
953383936 3:42494011-42494033 CTGCTGGCTGCTGCCTGGTGAGG - Intronic
955984208 3:64556184-64556206 CACCTCGCTGCTGTTTGGTGCGG - Intronic
960819923 3:121718651-121718673 CTCTTCGTTGCTGCTGGATGGGG - Intronic
961821362 3:129577309-129577331 TTCTTCCCAGCTGTGTGGTGGGG - Intronic
963537915 3:146551426-146551448 CTCTTCTCTTCTGCATGCTGGGG + Intergenic
965559391 3:170047023-170047045 CTCTGCCCTGCTGCTTGGAGGGG - Intronic
965900035 3:173628278-173628300 CACTTAGCTACTGGGTGGTGGGG + Intronic
968189808 3:196659717-196659739 CTCCTCGCTGCTGACCGGTGTGG + Intronic
969577759 4:8046463-8046485 CTCTTGGCTGCTGAGGGCTGGGG - Intronic
969908211 4:10417385-10417407 CTCTTTGCTGCTGCCATGTGAGG - Intergenic
973821219 4:54663267-54663289 CTCTTCCCTGCTGTGTGCTCTGG + Intronic
978365304 4:107974975-107974997 CTCTTTCCTGCTGCCTTGTGAGG + Intergenic
983028044 4:162761292-162761314 CTCTTCTCTGCAGCCTTGTGTGG - Intergenic
989125686 5:38050479-38050501 ATCTTCACTGCAGAGTGGTGGGG - Intergenic
990162511 5:52957631-52957653 CTCTTCTCAGCTGCGTGGTGGGG + Exonic
990546409 5:56826160-56826182 CTCTTTCCAGCTCCGTGGTGAGG + Intronic
997893406 5:137694950-137694972 CTCTTGGATGGTGGGTGGTGGGG - Intronic
998997632 5:147883020-147883042 CTCTGCTCTGCTGTGTGTTGAGG + Intronic
1001591818 5:172870798-172870820 CTCATTGCTGGTGGGTGGTGAGG + Intronic
1001789852 5:174446719-174446741 CTCTTAGCAACTGCATGGTGAGG - Intergenic
1002433955 5:179220122-179220144 CACTTGGCTGCCGCGTGCTGCGG - Intronic
1004045668 6:12020467-12020489 CTCATCGCTGCTCTGTGGAGGGG + Intronic
1004201734 6:13555050-13555072 CTCTTCCCAGCTGCGTGGTGAGG - Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1014486787 6:122008964-122008986 CACTTCGCTTTTGCCTGGTGAGG - Intergenic
1016438903 6:144064169-144064191 CTCTTCGCTTCTGCGCTGGGCGG - Intronic
1017754053 6:157514747-157514769 CTCTTCCCCGCTGGGCGGTGGGG + Intronic
1018945927 6:168346546-168346568 CTCCTCCCTGTTGCGGGGTGGGG - Intergenic
1020560861 7:9727710-9727732 TGCTTCGCTGCTGGGTGATGTGG - Intergenic
1022041692 7:26587792-26587814 CTGTTCACAGCAGCGTGGTGGGG + Intergenic
1023865084 7:44234670-44234692 CTCTTGGCTGCTGCATGGGGAGG + Exonic
1029109508 7:98205455-98205477 GTCTTCGCTGCTTCCTGTTGAGG - Exonic
1029852662 7:103481013-103481035 CTCTTGGGTGCTGTGTGCTGAGG + Intronic
1030536407 7:110772336-110772358 CTCTTCTCTGCTGTCTGGTCAGG + Intronic
1035222266 7:157413051-157413073 CCTGTCCCTGCTGCGTGGTGTGG + Intronic
1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG + Intronic
1038400407 8:27280177-27280199 CTGGTCACTGCGGCGTGGTGAGG - Intergenic
1049157148 8:141074057-141074079 CTCTCAGCTACTGCGTGCTGGGG + Intergenic
1049776230 8:144406664-144406686 CTCTGCACTGCTGCCTGATGTGG + Intronic
1051120238 9:13744717-13744739 CTCTTCGCAGCTGGCTGATGGGG + Intergenic
1053483751 9:38436549-38436571 CTCTTCACTCCTGCCTGGAGTGG - Intergenic
1055623492 9:78149923-78149945 CTCTTCCCTGCTGCCAGGAGTGG + Intergenic
1055662583 9:78520016-78520038 CTCTTGGCTGCTGTGGGCTGAGG + Intergenic
1057751260 9:97795085-97795107 CACTGTGCTGCTGGGTGGTGTGG + Intergenic
1057898398 9:98927975-98927997 CTCATGGCTGCTGCCTGGGGAGG - Intergenic
1060826987 9:126693257-126693279 CTCTTCGCTGCTGCGTGGTGAGG - Exonic
1061836085 9:133331312-133331334 CTCTTGGCTTCTGCCTGTTGGGG - Exonic
1062362150 9:136193248-136193270 CTCTGGGCTGCAGCGAGGTGAGG - Intergenic
1190329209 X:49225438-49225460 CTCTTCGCTGCTTCATGAAGTGG + Intronic