ID: 1060829725

View in Genome Browser
Species Human (GRCh38)
Location 9:126705997-126706019
Sequence GCCAGGGTGCTGCGGGTAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060829725_1060829740 23 Left 1060829725 9:126705997-126706019 CCGCTTACCCGCAGCACCCTGGC No data
Right 1060829740 9:126706043-126706065 AGCTCCTCGAGCCCGGAGGGAGG No data
1060829725_1060829739 20 Left 1060829725 9:126705997-126706019 CCGCTTACCCGCAGCACCCTGGC No data
Right 1060829739 9:126706040-126706062 CGCAGCTCCTCGAGCCCGGAGGG No data
1060829725_1060829741 24 Left 1060829725 9:126705997-126706019 CCGCTTACCCGCAGCACCCTGGC No data
Right 1060829741 9:126706044-126706066 GCTCCTCGAGCCCGGAGGGAGGG No data
1060829725_1060829738 19 Left 1060829725 9:126705997-126706019 CCGCTTACCCGCAGCACCCTGGC No data
Right 1060829738 9:126706039-126706061 CCGCAGCTCCTCGAGCCCGGAGG No data
1060829725_1060829735 16 Left 1060829725 9:126705997-126706019 CCGCTTACCCGCAGCACCCTGGC No data
Right 1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060829725 Original CRISPR GCCAGGGTGCTGCGGGTAAG CGG (reversed) Intergenic
No off target data available for this crispr