ID: 1060829733

View in Genome Browser
Species Human (GRCh38)
Location 9:126706021-126706043
Sequence TGCGGGTAAGCGCCGTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060829733_1060829739 -4 Left 1060829733 9:126706021-126706043 CCTGCCTACGGCGCTTACCCGCA No data
Right 1060829739 9:126706040-126706062 CGCAGCTCCTCGAGCCCGGAGGG No data
1060829733_1060829743 8 Left 1060829733 9:126706021-126706043 CCTGCCTACGGCGCTTACCCGCA No data
Right 1060829743 9:126706052-126706074 AGCCCGGAGGGAGGGCCATGAGG No data
1060829733_1060829746 11 Left 1060829733 9:126706021-126706043 CCTGCCTACGGCGCTTACCCGCA No data
Right 1060829746 9:126706055-126706077 CCGGAGGGAGGGCCATGAGGTGG No data
1060829733_1060829741 0 Left 1060829733 9:126706021-126706043 CCTGCCTACGGCGCTTACCCGCA No data
Right 1060829741 9:126706044-126706066 GCTCCTCGAGCCCGGAGGGAGGG No data
1060829733_1060829738 -5 Left 1060829733 9:126706021-126706043 CCTGCCTACGGCGCTTACCCGCA No data
Right 1060829738 9:126706039-126706061 CCGCAGCTCCTCGAGCCCGGAGG No data
1060829733_1060829749 20 Left 1060829733 9:126706021-126706043 CCTGCCTACGGCGCTTACCCGCA No data
Right 1060829749 9:126706064-126706086 GGGCCATGAGGTGGAAGTAGGGG No data
1060829733_1060829747 18 Left 1060829733 9:126706021-126706043 CCTGCCTACGGCGCTTACCCGCA No data
Right 1060829747 9:126706062-126706084 GAGGGCCATGAGGTGGAAGTAGG No data
1060829733_1060829740 -1 Left 1060829733 9:126706021-126706043 CCTGCCTACGGCGCTTACCCGCA No data
Right 1060829740 9:126706043-126706065 AGCTCCTCGAGCCCGGAGGGAGG No data
1060829733_1060829735 -8 Left 1060829733 9:126706021-126706043 CCTGCCTACGGCGCTTACCCGCA No data
Right 1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG No data
1060829733_1060829748 19 Left 1060829733 9:126706021-126706043 CCTGCCTACGGCGCTTACCCGCA No data
Right 1060829748 9:126706063-126706085 AGGGCCATGAGGTGGAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060829733 Original CRISPR TGCGGGTAAGCGCCGTAGGC AGG (reversed) Intergenic
No off target data available for this crispr