ID: 1060829735

View in Genome Browser
Species Human (GRCh38)
Location 9:126706036-126706058
Sequence TACCCGCAGCTCCTCGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060829725_1060829735 16 Left 1060829725 9:126705997-126706019 CCGCTTACCCGCAGCACCCTGGC No data
Right 1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG No data
1060829729_1060829735 0 Left 1060829729 9:126706013-126706035 CCCTGGCCCCTGCCTACGGCGCT No data
Right 1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG No data
1060829726_1060829735 9 Left 1060829726 9:126706004-126706026 CCCGCAGCACCCTGGCCCCTGCC No data
Right 1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG No data
1060829723_1060829735 17 Left 1060829723 9:126705996-126706018 CCCGCTTACCCGCAGCACCCTGG No data
Right 1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG No data
1060829733_1060829735 -8 Left 1060829733 9:126706021-126706043 CCTGCCTACGGCGCTTACCCGCA No data
Right 1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG No data
1060829727_1060829735 8 Left 1060829727 9:126706005-126706027 CCGCAGCACCCTGGCCCCTGCCT No data
Right 1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG No data
1060829731_1060829735 -6 Left 1060829731 9:126706019-126706041 CCCCTGCCTACGGCGCTTACCCG No data
Right 1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG No data
1060829721_1060829735 24 Left 1060829721 9:126705989-126706011 CCGTGGCCCCGCTTACCCGCAGC No data
Right 1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG No data
1060829730_1060829735 -1 Left 1060829730 9:126706014-126706036 CCTGGCCCCTGCCTACGGCGCTT No data
Right 1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG No data
1060829722_1060829735 18 Left 1060829722 9:126705995-126706017 CCCCGCTTACCCGCAGCACCCTG No data
Right 1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG No data
1060829732_1060829735 -7 Left 1060829732 9:126706020-126706042 CCCTGCCTACGGCGCTTACCCGC No data
Right 1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060829735 Original CRISPR TACCCGCAGCTCCTCGAGCC CGG Intergenic
No off target data available for this crispr