ID: 1060832074

View in Genome Browser
Species Human (GRCh38)
Location 9:126723070-126723092
Sequence GGTCCCGATCCCCGAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060832074_1060832080 3 Left 1060832074 9:126723070-126723092 CCAGGCACTCGGGGATCGGGACC No data
Right 1060832080 9:126723096-126723118 CCAACGGCCCCAGTCCCAGGCGG No data
1060832074_1060832087 15 Left 1060832074 9:126723070-126723092 CCAGGCACTCGGGGATCGGGACC No data
Right 1060832087 9:126723108-126723130 GTCCCAGGCGGGGGCCGAGCTGG No data
1060832074_1060832082 5 Left 1060832074 9:126723070-126723092 CCAGGCACTCGGGGATCGGGACC No data
Right 1060832082 9:126723098-126723120 AACGGCCCCAGTCCCAGGCGGGG No data
1060832074_1060832083 6 Left 1060832074 9:126723070-126723092 CCAGGCACTCGGGGATCGGGACC No data
Right 1060832083 9:126723099-126723121 ACGGCCCCAGTCCCAGGCGGGGG No data
1060832074_1060832078 0 Left 1060832074 9:126723070-126723092 CCAGGCACTCGGGGATCGGGACC No data
Right 1060832078 9:126723093-126723115 CAGCCAACGGCCCCAGTCCCAGG No data
1060832074_1060832081 4 Left 1060832074 9:126723070-126723092 CCAGGCACTCGGGGATCGGGACC No data
Right 1060832081 9:126723097-126723119 CAACGGCCCCAGTCCCAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060832074 Original CRISPR GGTCCCGATCCCCGAGTGCC TGG (reversed) Intergenic