ID: 1060832082

View in Genome Browser
Species Human (GRCh38)
Location 9:126723098-126723120
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060832072_1060832082 7 Left 1060832072 9:126723068-126723090 CCCCAGGCACTCGGGGATCGGGA No data
Right 1060832082 9:126723098-126723120 AACGGCCCCAGTCCCAGGCGGGG No data
1060832074_1060832082 5 Left 1060832074 9:126723070-126723092 CCAGGCACTCGGGGATCGGGACC No data
Right 1060832082 9:126723098-126723120 AACGGCCCCAGTCCCAGGCGGGG No data
1060832066_1060832082 16 Left 1060832066 9:126723059-126723081 CCAGCGCTGCCCCAGGCACTCGG No data
Right 1060832082 9:126723098-126723120 AACGGCCCCAGTCCCAGGCGGGG No data
1060832073_1060832082 6 Left 1060832073 9:126723069-126723091 CCCAGGCACTCGGGGATCGGGAC No data
Right 1060832082 9:126723098-126723120 AACGGCCCCAGTCCCAGGCGGGG No data
1060832065_1060832082 21 Left 1060832065 9:126723054-126723076 CCTTTCCAGCGCTGCCCCAGGCA No data
Right 1060832082 9:126723098-126723120 AACGGCCCCAGTCCCAGGCGGGG No data
1060832064_1060832082 22 Left 1060832064 9:126723053-126723075 CCCTTTCCAGCGCTGCCCCAGGC No data
Right 1060832082 9:126723098-126723120 AACGGCCCCAGTCCCAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060832082 Original CRISPR AACGGCCCCAGTCCCAGGCG GGG Intergenic