ID: 1060832087

View in Genome Browser
Species Human (GRCh38)
Location 9:126723108-126723130
Sequence GTCCCAGGCGGGGGCCGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060832077_1060832087 -7 Left 1060832077 9:126723092-126723114 CCAGCCAACGGCCCCAGTCCCAG No data
Right 1060832087 9:126723108-126723130 GTCCCAGGCGGGGGCCGAGCTGG No data
1060832066_1060832087 26 Left 1060832066 9:126723059-126723081 CCAGCGCTGCCCCAGGCACTCGG No data
Right 1060832087 9:126723108-126723130 GTCCCAGGCGGGGGCCGAGCTGG No data
1060832073_1060832087 16 Left 1060832073 9:126723069-126723091 CCCAGGCACTCGGGGATCGGGAC No data
Right 1060832087 9:126723108-126723130 GTCCCAGGCGGGGGCCGAGCTGG No data
1060832074_1060832087 15 Left 1060832074 9:126723070-126723092 CCAGGCACTCGGGGATCGGGACC No data
Right 1060832087 9:126723108-126723130 GTCCCAGGCGGGGGCCGAGCTGG No data
1060832076_1060832087 -6 Left 1060832076 9:126723091-126723113 CCCAGCCAACGGCCCCAGTCCCA No data
Right 1060832087 9:126723108-126723130 GTCCCAGGCGGGGGCCGAGCTGG No data
1060832072_1060832087 17 Left 1060832072 9:126723068-126723090 CCCCAGGCACTCGGGGATCGGGA No data
Right 1060832087 9:126723108-126723130 GTCCCAGGCGGGGGCCGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060832087 Original CRISPR GTCCCAGGCGGGGGCCGAGC TGG Intergenic