ID: 1060832421

View in Genome Browser
Species Human (GRCh38)
Location 9:126724785-126724807
Sequence AAGGAGAGGGCACACACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060832421_1060832427 -3 Left 1060832421 9:126724785-126724807 CCACCTGTGTGTGCCCTCTCCTT No data
Right 1060832427 9:126724805-126724827 CTTTGTTTCCGTGTGGCTGCAGG No data
1060832421_1060832432 11 Left 1060832421 9:126724785-126724807 CCACCTGTGTGTGCCCTCTCCTT No data
Right 1060832432 9:126724819-126724841 GGCTGCAGGCTGGAGGACCAGGG No data
1060832421_1060832429 4 Left 1060832421 9:126724785-126724807 CCACCTGTGTGTGCCCTCTCCTT No data
Right 1060832429 9:126724812-126724834 TCCGTGTGGCTGCAGGCTGGAGG No data
1060832421_1060832424 -10 Left 1060832421 9:126724785-126724807 CCACCTGTGTGTGCCCTCTCCTT No data
Right 1060832424 9:126724798-126724820 CCCTCTCCTTTGTTTCCGTGTGG No data
1060832421_1060832428 1 Left 1060832421 9:126724785-126724807 CCACCTGTGTGTGCCCTCTCCTT No data
Right 1060832428 9:126724809-126724831 GTTTCCGTGTGGCTGCAGGCTGG No data
1060832421_1060832433 27 Left 1060832421 9:126724785-126724807 CCACCTGTGTGTGCCCTCTCCTT No data
Right 1060832433 9:126724835-126724857 ACCAGGGATTGTCTGTCATAAGG No data
1060832421_1060832431 10 Left 1060832421 9:126724785-126724807 CCACCTGTGTGTGCCCTCTCCTT No data
Right 1060832431 9:126724818-126724840 TGGCTGCAGGCTGGAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060832421 Original CRISPR AAGGAGAGGGCACACACAGG TGG (reversed) Intergenic