ID: 1060832424

View in Genome Browser
Species Human (GRCh38)
Location 9:126724798-126724820
Sequence CCCTCTCCTTTGTTTCCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060832421_1060832424 -10 Left 1060832421 9:126724785-126724807 CCACCTGTGTGTGCCCTCTCCTT No data
Right 1060832424 9:126724798-126724820 CCCTCTCCTTTGTTTCCGTGTGG No data
1060832419_1060832424 2 Left 1060832419 9:126724773-126724795 CCTAGAACCAGTCCACCTGTGTG No data
Right 1060832424 9:126724798-126724820 CCCTCTCCTTTGTTTCCGTGTGG No data
1060832420_1060832424 -5 Left 1060832420 9:126724780-126724802 CCAGTCCACCTGTGTGTGCCCTC No data
Right 1060832424 9:126724798-126724820 CCCTCTCCTTTGTTTCCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060832424 Original CRISPR CCCTCTCCTTTGTTTCCGTG TGG Intergenic
No off target data available for this crispr