ID: 1060834556

View in Genome Browser
Species Human (GRCh38)
Location 9:126745303-126745325
Sequence TCACCCAGGCTGGAGTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 755785
Summary {0: 81688, 1: 171766, 2: 204013, 3: 179579, 4: 118739}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060834556_1060834563 30 Left 1060834556 9:126745303-126745325 CCACTGCACTCCAGCCTGGGTGA 0: 81688
1: 171766
2: 204013
3: 179579
4: 118739
Right 1060834563 9:126745356-126745378 TTAATACAGAGATGGAGCAAGGG No data
1060834556_1060834561 22 Left 1060834556 9:126745303-126745325 CCACTGCACTCCAGCCTGGGTGA 0: 81688
1: 171766
2: 204013
3: 179579
4: 118739
Right 1060834561 9:126745348-126745370 AAAAAAAATTAATACAGAGATGG No data
1060834556_1060834562 29 Left 1060834556 9:126745303-126745325 CCACTGCACTCCAGCCTGGGTGA 0: 81688
1: 171766
2: 204013
3: 179579
4: 118739
Right 1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060834556 Original CRISPR TCACCCAGGCTGGAGTGCAG TGG (reversed) Intergenic
Too many off-targets to display for this crispr