ID: 1060834557

View in Genome Browser
Species Human (GRCh38)
Location 9:126745313-126745335
Sequence TCTCACTCTGTCACCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 584294
Summary {0: 30388, 1: 79844, 2: 153170, 3: 168549, 4: 152343}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060834557_1060834561 12 Left 1060834557 9:126745313-126745335 CCAGCCTGGGTGACAGAGTGAGA 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
Right 1060834561 9:126745348-126745370 AAAAAAAATTAATACAGAGATGG No data
1060834557_1060834563 20 Left 1060834557 9:126745313-126745335 CCAGCCTGGGTGACAGAGTGAGA 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
Right 1060834563 9:126745356-126745378 TTAATACAGAGATGGAGCAAGGG No data
1060834557_1060834565 26 Left 1060834557 9:126745313-126745335 CCAGCCTGGGTGACAGAGTGAGA 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
Right 1060834565 9:126745362-126745384 CAGAGATGGAGCAAGGGCCTGGG No data
1060834557_1060834562 19 Left 1060834557 9:126745313-126745335 CCAGCCTGGGTGACAGAGTGAGA 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
Right 1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG No data
1060834557_1060834564 25 Left 1060834557 9:126745313-126745335 CCAGCCTGGGTGACAGAGTGAGA 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
Right 1060834564 9:126745361-126745383 ACAGAGATGGAGCAAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060834557 Original CRISPR TCTCACTCTGTCACCCAGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr