ID: 1060834558

View in Genome Browser
Species Human (GRCh38)
Location 9:126745317-126745339
Sequence GGAATCTCACTCTGTCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326467
Summary {0: 601, 1: 13816, 2: 51224, 3: 115031, 4: 145795}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060834558_1060834564 21 Left 1060834558 9:126745317-126745339 CCTGGGTGACAGAGTGAGATTCC 0: 601
1: 13816
2: 51224
3: 115031
4: 145795
Right 1060834564 9:126745361-126745383 ACAGAGATGGAGCAAGGGCCTGG No data
1060834558_1060834563 16 Left 1060834558 9:126745317-126745339 CCTGGGTGACAGAGTGAGATTCC 0: 601
1: 13816
2: 51224
3: 115031
4: 145795
Right 1060834563 9:126745356-126745378 TTAATACAGAGATGGAGCAAGGG No data
1060834558_1060834565 22 Left 1060834558 9:126745317-126745339 CCTGGGTGACAGAGTGAGATTCC 0: 601
1: 13816
2: 51224
3: 115031
4: 145795
Right 1060834565 9:126745362-126745384 CAGAGATGGAGCAAGGGCCTGGG No data
1060834558_1060834562 15 Left 1060834558 9:126745317-126745339 CCTGGGTGACAGAGTGAGATTCC 0: 601
1: 13816
2: 51224
3: 115031
4: 145795
Right 1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG No data
1060834558_1060834561 8 Left 1060834558 9:126745317-126745339 CCTGGGTGACAGAGTGAGATTCC 0: 601
1: 13816
2: 51224
3: 115031
4: 145795
Right 1060834561 9:126745348-126745370 AAAAAAAATTAATACAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060834558 Original CRISPR GGAATCTCACTCTGTCACCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr