ID: 1060834559

View in Genome Browser
Species Human (GRCh38)
Location 9:126745338-126745360
Sequence ATTAATTTTTTTTTTGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060834559_1060834563 -5 Left 1060834559 9:126745338-126745360 CCATCTCCAAAAAAAAAATTAAT No data
Right 1060834563 9:126745356-126745378 TTAATACAGAGATGGAGCAAGGG No data
1060834559_1060834568 21 Left 1060834559 9:126745338-126745360 CCATCTCCAAAAAAAAAATTAAT No data
Right 1060834568 9:126745382-126745404 GGGAGAACGTGCAAGAGAGGAGG No data
1060834559_1060834565 1 Left 1060834559 9:126745338-126745360 CCATCTCCAAAAAAAAAATTAAT No data
Right 1060834565 9:126745362-126745384 CAGAGATGGAGCAAGGGCCTGGG No data
1060834559_1060834567 18 Left 1060834559 9:126745338-126745360 CCATCTCCAAAAAAAAAATTAAT No data
Right 1060834567 9:126745379-126745401 CCTGGGAGAACGTGCAAGAGAGG No data
1060834559_1060834569 28 Left 1060834559 9:126745338-126745360 CCATCTCCAAAAAAAAAATTAAT No data
Right 1060834569 9:126745389-126745411 CGTGCAAGAGAGGAGGATGCTGG No data
1060834559_1060834562 -6 Left 1060834559 9:126745338-126745360 CCATCTCCAAAAAAAAAATTAAT No data
Right 1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG No data
1060834559_1060834564 0 Left 1060834559 9:126745338-126745360 CCATCTCCAAAAAAAAAATTAAT No data
Right 1060834564 9:126745361-126745383 ACAGAGATGGAGCAAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060834559 Original CRISPR ATTAATTTTTTTTTTGGAGA TGG (reversed) Intergenic
No off target data available for this crispr