ID: 1060834562

View in Genome Browser
Species Human (GRCh38)
Location 9:126745355-126745377
Sequence ATTAATACAGAGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060834558_1060834562 15 Left 1060834558 9:126745317-126745339 CCTGGGTGACAGAGTGAGATTCC 0: 601
1: 13816
2: 51224
3: 115031
4: 145795
Right 1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG No data
1060834559_1060834562 -6 Left 1060834559 9:126745338-126745360 CCATCTCCAAAAAAAAAATTAAT No data
Right 1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG No data
1060834557_1060834562 19 Left 1060834557 9:126745313-126745335 CCAGCCTGGGTGACAGAGTGAGA 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
Right 1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG No data
1060834556_1060834562 29 Left 1060834556 9:126745303-126745325 CCACTGCACTCCAGCCTGGGTGA 0: 81688
1: 171766
2: 204013
3: 179579
4: 118739
Right 1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060834562 Original CRISPR ATTAATACAGAGATGGAGCA AGG Intergenic
No off target data available for this crispr