ID: 1060836166

View in Genome Browser
Species Human (GRCh38)
Location 9:126756526-126756548
Sequence CACTGATTCCGCCCCAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060836166_1060836171 -1 Left 1060836166 9:126756526-126756548 CCTCCCTTGGGGCGGAATCAGTG No data
Right 1060836171 9:126756548-126756570 GAGGGATGCAGAGAAAAGTCAGG No data
1060836166_1060836172 13 Left 1060836166 9:126756526-126756548 CCTCCCTTGGGGCGGAATCAGTG No data
Right 1060836172 9:126756562-126756584 AAAGTCAGGAGTATTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060836166 Original CRISPR CACTGATTCCGCCCCAAGGG AGG (reversed) Intergenic
No off target data available for this crispr