ID: 1060839068

View in Genome Browser
Species Human (GRCh38)
Location 9:126780177-126780199
Sequence TTGTCTATGAGACAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060839058_1060839068 10 Left 1060839058 9:126780144-126780166 CCTGTCCTGAGCCCCCGTTTGCA No data
Right 1060839068 9:126780177-126780199 TTGTCTATGAGACAGGAGGAGGG No data
1060839063_1060839068 -3 Left 1060839063 9:126780157-126780179 CCCGTTTGCAATCTTCTTGGTTG No data
Right 1060839068 9:126780177-126780199 TTGTCTATGAGACAGGAGGAGGG No data
1060839062_1060839068 -2 Left 1060839062 9:126780156-126780178 CCCCGTTTGCAATCTTCTTGGTT No data
Right 1060839068 9:126780177-126780199 TTGTCTATGAGACAGGAGGAGGG No data
1060839064_1060839068 -4 Left 1060839064 9:126780158-126780180 CCGTTTGCAATCTTCTTGGTTGT No data
Right 1060839068 9:126780177-126780199 TTGTCTATGAGACAGGAGGAGGG No data
1060839061_1060839068 -1 Left 1060839061 9:126780155-126780177 CCCCCGTTTGCAATCTTCTTGGT No data
Right 1060839068 9:126780177-126780199 TTGTCTATGAGACAGGAGGAGGG No data
1060839059_1060839068 5 Left 1060839059 9:126780149-126780171 CCTGAGCCCCCGTTTGCAATCTT No data
Right 1060839068 9:126780177-126780199 TTGTCTATGAGACAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060839068 Original CRISPR TTGTCTATGAGACAGGAGGA GGG Intergenic
No off target data available for this crispr