ID: 1060839453

View in Genome Browser
Species Human (GRCh38)
Location 9:126782235-126782257
Sequence CACACAGTGAATGCAGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060839453_1060839459 22 Left 1060839453 9:126782235-126782257 CCCTCACCTGCATTCACTGTGTG No data
Right 1060839459 9:126782280-126782302 GACATTTGTTGTATCACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060839453 Original CRISPR CACACAGTGAATGCAGGTGA GGG (reversed) Intergenic
No off target data available for this crispr