ID: 1060845927

View in Genome Browser
Species Human (GRCh38)
Location 9:126837538-126837560
Sequence CCTCCTGGGTGGGCGTGGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 361}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060845918_1060845927 2 Left 1060845918 9:126837513-126837535 CCCTGGGGAAGGGGATGTGCTGC 0: 1
1: 0
2: 8
3: 44
4: 391
Right 1060845927 9:126837538-126837560 CCTCCTGGGTGGGCGTGGAGAGG 0: 1
1: 0
2: 4
3: 47
4: 361
1060845919_1060845927 1 Left 1060845919 9:126837514-126837536 CCTGGGGAAGGGGATGTGCTGCG 0: 1
1: 0
2: 2
3: 33
4: 252
Right 1060845927 9:126837538-126837560 CCTCCTGGGTGGGCGTGGAGAGG 0: 1
1: 0
2: 4
3: 47
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060845927 Original CRISPR CCTCCTGGGTGGGCGTGGAG AGG Exonic
900462195 1:2807036-2807058 CCTGCGGGGTGGGGGTGGGGTGG + Intergenic
900636637 1:3669272-3669294 CCTCCTGGGAGGCCGTAGAGGGG - Intronic
900644425 1:3702565-3702587 CCTCCTGGGTGGGTGCGTGGGGG + Intronic
900781987 1:4624415-4624437 CCTCCTAGATGGGCATCGAGAGG + Intergenic
901000472 1:6146587-6146609 CCTCCTGGGCTGGCGGGAAGGGG - Intronic
901061868 1:6475369-6475391 CCTCCGGGATGGGGGTGGGGAGG - Intronic
901665825 1:10825709-10825731 CCTCCTGGATGGCAGGGGAGGGG - Intergenic
902394305 1:16124273-16124295 CTTCCTGGGTGGGAGTTGAGGGG - Intergenic
902408293 1:16198527-16198549 GCTCCTGGATGGTCCTGGAGGGG - Exonic
904627576 1:31815539-31815561 TGTCCTGGGTGAGGGTGGAGAGG + Intronic
904897221 1:33826006-33826028 CCTACTGGGTGGGCTCTGAGAGG + Intronic
905505561 1:38476526-38476548 GCTCCTGGGTGGGGGGGGCGCGG - Intergenic
905787291 1:40768444-40768466 CCTCATGGGTAGGCCTGCAGGGG + Intronic
906145487 1:43557986-43558008 CCTCCTAGGAGGGAGGGGAGGGG - Intronic
908544000 1:65147472-65147494 CAGGCTGGGTGGGAGTGGAGTGG + Intergenic
911078873 1:93909037-93909059 CCTCCTCGCTGTGCGTGGACGGG + Exonic
911184033 1:94885984-94886006 CCACCGAGGTGGGGGTGGAGGGG + Intronic
911186779 1:94912407-94912429 CCCTCTGGGTGGGGATGGAGTGG - Intronic
912907994 1:113727850-113727872 CCTCCTGAGTAGGCTTGGAGTGG - Intronic
915088242 1:153403579-153403601 CCCACAGGGTGGACGTGGAGTGG - Intergenic
918122191 1:181549819-181549841 CCACTGGAGTGGGCGTGGAGTGG + Intronic
919795083 1:201316717-201316739 CCTCCTTGGTGGGCCTGCGGAGG + Intronic
920253808 1:204640484-204640506 CCTCCTGGAAGGGCGTTCAGGGG + Intronic
921297863 1:213721721-213721743 TCTCTTGGGTGGGTGTGCAGTGG - Intergenic
1062767495 10:76552-76574 CCTCCGGGGTGGGTGCTGAGAGG + Intergenic
1062786536 10:269869-269891 GCTCCTGGGTGTGCTTGGGGCGG - Intergenic
1064352137 10:14586003-14586025 CCTCTTGCTTGGGCGTGCAGGGG + Intronic
1064404918 10:15053191-15053213 ATTCCTGGCTGGGGGTGGAGGGG - Intronic
1064474830 10:15676425-15676447 TCTCCTGGGTGGCTGTGGACAGG - Intronic
1064604358 10:17023189-17023211 AGTACTGGGTGGGGGTGGAGGGG + Intronic
1064944125 10:20769414-20769436 TCTCCTGTGGGGTCGTGGAGTGG - Intergenic
1064998676 10:21317975-21317997 GCTCCTGGTTGGGCTGGGAGTGG - Intergenic
1067048486 10:42999151-42999173 CCTCCTGGGTGACCCTGGAGGGG - Intergenic
1069606304 10:69740855-69740877 TCTCCTGGGTGTGCGTGTGGCGG - Intergenic
1069826377 10:71257430-71257452 TCGCCTGGGTGGGCCTGGAGGGG - Intronic
1070593711 10:77818188-77818210 CAACCTGGGTGGGCCTGGGGAGG + Intronic
1071507315 10:86240572-86240594 CCTCTTGGGTGGGTGCGGCGGGG + Intronic
1071530604 10:86388258-86388280 CCTCGGGGGTGGTCGCGGAGGGG - Intergenic
1073453673 10:103623823-103623845 CCTCCTGGTGGGGCAGGGAGAGG + Intronic
1075131472 10:119743496-119743518 TCTGCTGGGTGTGGGTGGAGTGG + Intronic
1075608718 10:123834796-123834818 CCTCCTTGGTGGGGGTGCAGGGG + Intronic
1076327891 10:129642582-129642604 CCTCAGGGGTGTGTGTGGAGGGG + Intronic
1076722169 10:132397431-132397453 CCTCCGGGTTGGGGGTGGCGTGG + Intronic
1076804272 10:132847361-132847383 CCTGCTTGGTCGGCGTGGGGAGG + Intronic
1077115128 11:880656-880678 CCTCCTGGTCGGCCGTGGGGAGG - Intronic
1077391181 11:2301298-2301320 ACTCCTGGGAGGGCCCGGAGTGG + Intronic
1077439299 11:2560527-2560549 CCTTCTGGGGGGGCGGGGGGGGG + Intronic
1078774480 11:14381549-14381571 CCCCCTGGGTGGAAATGGAGGGG - Intergenic
1081551307 11:44115014-44115036 CCTTCTGGGATGGGGTGGAGGGG + Intronic
1081774404 11:45667433-45667455 CTCCCTGGGTGGGGGTGGGGAGG - Intergenic
1082812765 11:57488627-57488649 TCTTCAGGGTGGGCATGGAGGGG + Intronic
1084043807 11:66557614-66557636 CAGCCTGGGTGTGGGTGGAGAGG + Intronic
1084154057 11:67303974-67303996 CCTCCCGGTGGGGCGTGGACTGG + Intronic
1084438865 11:69159278-69159300 CCCCCAGGGTGGGCATGGAGTGG + Intergenic
1084543083 11:69799300-69799322 TCTCATGGCTGGGCCTGGAGTGG + Intergenic
1084653533 11:70502488-70502510 CCTCATGGGTGGGCCTGGGCAGG + Intronic
1084661722 11:70550168-70550190 GCTGCTGGGTGGGCATAGAGGGG - Intronic
1084957179 11:72697638-72697660 CCCCCTGGATGGCTGTGGAGGGG + Exonic
1085305672 11:75484393-75484415 ACGCCTGGGTAGGAGTGGAGAGG - Intronic
1087078883 11:94150908-94150930 CCTCCAGGGTGGCCTTGCAGGGG + Intronic
1087191050 11:95255042-95255064 TCTCATGGGTGGGAGTGGAGAGG + Intergenic
1089474065 11:118744078-118744100 CCTCATGGGAGGTGGTGGAGGGG - Intergenic
1089534668 11:119153747-119153769 TCTCATGGATGGGCGTGGAGAGG - Intronic
1089936893 11:122373828-122373850 CATCCTGGGTGGGTATGAAGTGG + Intergenic
1091827435 12:3523446-3523468 AATCCTGGGTGGGCTTGGGGTGG - Intronic
1091915424 12:4269493-4269515 CCTCCCGGGGGCGCCTGGAGGGG + Intergenic
1092143875 12:6201435-6201457 CCGCCTGGGCTGGCGGGGAGGGG - Intronic
1092214015 12:6667845-6667867 CCCCCAGGGTGGGGGTGGTGGGG - Exonic
1092240182 12:6831360-6831382 CCTCCCAGGTGAGCGTGGAGAGG - Intronic
1092265496 12:6977570-6977592 CCTCCAGGGTGGGGGTGAAGGGG - Intronic
1094774920 12:33714615-33714637 GCTCCTGGGAGAGCATGGAGAGG - Intergenic
1095632875 12:44398603-44398625 CCTCCTGTGTGGGGGTGGGGTGG - Intergenic
1096614099 12:52821994-52822016 CTCCCTGGGTGGGAGTGGGGGGG - Exonic
1097009308 12:55941035-55941057 CCTCATGGGTGGGAATGAAGTGG + Intronic
1097175919 12:57142914-57142936 TCTCCTAGGTGGGGGTGGAGTGG + Intronic
1097221301 12:57452758-57452780 ACTCTTTGGTGGGGGTGGAGTGG - Intronic
1098482497 12:70982029-70982051 CACCCTGGGTGGGCATGGCGGGG + Intergenic
1101152889 12:101899637-101899659 TCACCTGGGTGGGAGTGCAGCGG - Intronic
1103330861 12:120153212-120153234 CCTGCTGGGAGGGGGTGGAGAGG + Exonic
1104010144 12:124924587-124924609 CCTCCTGAGTGGGGGTGGGGTGG - Intergenic
1104013555 12:124948270-124948292 CCTCCTGGGTGGGGCTGGTGGGG - Intronic
1104288581 12:127447607-127447629 CTTCCTGGGCGTGCATGGAGAGG + Intergenic
1104601974 12:130160995-130161017 CCTCCCGGGGGGCCGGGGAGAGG - Intergenic
1106083222 13:26517723-26517745 CCTCATGGCTGGGCAGGGAGGGG - Intergenic
1107530303 13:41276739-41276761 CCTCCAGGCTGGGGGAGGAGAGG + Intergenic
1112454081 13:99542212-99542234 CCTCCTGTGTGGGAATGGACTGG + Intronic
1112630024 13:101150236-101150258 CGTCCTGGGTGGGGGTGGCGGGG + Intronic
1113744182 13:112731426-112731448 ACTCCTGGCTGGGAATGGAGTGG - Intronic
1114270573 14:21098114-21098136 GCTCCTGGGGGGGCGGGGTGGGG - Intronic
1114422780 14:22598448-22598470 CCTCCGGGGAGGGCGGGGGGTGG + Intronic
1115948509 14:38693657-38693679 TGTCCTGGGTGGCGGTGGAGTGG - Intergenic
1117353343 14:54902022-54902044 CGCCCCGGGTGGGCGTGGACGGG - Intronic
1118511499 14:66479665-66479687 CCTCCTGAGGGGGCTTAGAGGGG - Intergenic
1119484925 14:74980975-74980997 CTTCCTGGGGCGTCGTGGAGGGG + Intergenic
1119631151 14:76233268-76233290 CCTGCTGCGTGGGGGTGGAGAGG - Intronic
1120363909 14:83541363-83541385 CCTTGTGGGTGGGGGAGGAGTGG + Intergenic
1121316414 14:92963628-92963650 TCCACTGGGTGGGCCTGGAGAGG - Intronic
1121633808 14:95440133-95440155 CCTGCAGGGTGGGGGTGGTGCGG - Intronic
1122087006 14:99314771-99314793 CATGCTAGGTGGGCTTGGAGAGG - Intergenic
1122183915 14:99974924-99974946 CCTCCTTGATGGGCAGGGAGAGG + Intronic
1122188771 14:100023242-100023264 TCACCTGGGTTGGCGTGCAGCGG + Intronic
1122262601 14:100531779-100531801 CCTGCTGGGTGGGGGTGATGGGG - Intergenic
1122745468 14:103894836-103894858 CCCCCAGGGTGGGGGTGGAGAGG + Intergenic
1123940226 15:25213142-25213164 CCTCCTTGGTTGGCTGGGAGCGG + Intergenic
1123944389 15:25231967-25231989 CCTCCTTGGTTGGCTGGGAGTGG + Intergenic
1124734855 15:32234778-32234800 CCTCCTGGGGGGTCTTTGAGTGG - Intergenic
1125674481 15:41494859-41494881 TCTCCTGAGTGGGAGTGGAGCGG + Intronic
1128214362 15:65924162-65924184 CCACCTGGGCTGGCGAGGAGAGG + Intronic
1128594335 15:68930438-68930460 CCTCCTGGGACCGCGTGCAGGGG - Intronic
1129294539 15:74592672-74592694 CTGCCTGGGTGGTCATGGAGGGG + Intronic
1131159055 15:90092614-90092636 CCCCCAGGGTGGGAGTGCAGTGG + Intronic
1131250744 15:90828407-90828429 GCTCCTGGGAGGGCTGGGAGTGG + Intergenic
1132301493 15:100779031-100779053 CCTCTGGGGTGGGGGTGGGGAGG - Intergenic
1132599612 16:767832-767854 GCGCATGGGGGGGCGTGGAGGGG + Intronic
1132599667 16:767968-767990 CCGTGTGGGGGGGCGTGGAGGGG + Intronic
1132844122 16:1992244-1992266 CCTTCCGGGTGGGCGGGGAGGGG + Intronic
1132844162 16:1992356-1992378 CCTCCCGGGTGGGCGGGGAGGGG + Intronic
1132870614 16:2114196-2114218 CCTCGGGGCTGGGCGTGGCGCGG + Exonic
1133394181 16:5432823-5432845 TCTCCTGGGTTGGAGTGCAGTGG + Intergenic
1133979451 16:10622446-10622468 CTTGCTGGGTGGGGGTGGGGAGG + Intergenic
1134521917 16:14922708-14922730 CCTCGGGGCTGGGCGTGGCGCGG - Intronic
1134709586 16:16321359-16321381 CCTCGGGGCTGGGCGTGGCGCGG - Intergenic
1134716800 16:16361388-16361410 CCTCGGGGCTGGGCGTGGCGCGG - Intergenic
1134950016 16:18347286-18347308 CCTCGGGGCTGGGCGTGGCGCGG + Intergenic
1134957952 16:18390771-18390793 CCTCGGGGCTGGGCGTGGCGCGG + Intergenic
1136359848 16:29771954-29771976 CCTTCTGGATGGGGGTGGAGAGG + Intergenic
1136524601 16:30820958-30820980 TCTCCGGGGTGGGCGTGGGGTGG - Intergenic
1136790551 16:32965546-32965568 CCTTGTGGGTGGGTGAGGAGTGG - Intergenic
1136879263 16:33888386-33888408 CCTTGTGGGTGGGTGAGGAGTGG + Intergenic
1137844794 16:51676580-51676602 TTTCCTGGGTGGACGTGGATAGG + Intergenic
1138562102 16:57807410-57807432 GCTCCTCAGTGGGCATGGAGAGG + Intronic
1139369570 16:66458425-66458447 CCTCCAGGGTGGGAGGGGAGGGG - Intronic
1139973272 16:70789808-70789830 CTTCCTGGGCAGGCGTGGGGAGG - Intronic
1141831372 16:86511478-86511500 GCTCCAGGGAGTGCGTGGAGAGG - Exonic
1141856435 16:86684541-86684563 CCTCCCAGGTGGGCTAGGAGAGG - Intergenic
1142199631 16:88754913-88754935 GCTCCTGTGCAGGCGTGGAGCGG - Intronic
1203092754 16_KI270728v1_random:1227004-1227026 CCTTGTGGGTGGGTGAGGAGTGG - Intergenic
1142685336 17:1574491-1574513 CCTCCTGGGCGTGCTTAGAGGGG - Exonic
1142702672 17:1673650-1673672 CGTCCTGGGTGGGAGAGGCGTGG - Intronic
1142743127 17:1942075-1942097 CCTCCTGGGTGGGCCAGGGGTGG + Intronic
1142871912 17:2826624-2826646 CCTCTTGGCTGGGGTTGGAGGGG + Intronic
1142994365 17:3751969-3751991 CATCCTGGGTGGCAATGGAGTGG - Intronic
1142994378 17:3752016-3752038 CATCCTGGGTGGCAATGGAGTGG - Intronic
1143093991 17:4467004-4467026 CCATGTGGGTGGGGGTGGAGCGG + Intronic
1143513400 17:7407792-7407814 GCTGCTGGGTGGGAGTGGGGAGG + Intronic
1144813591 17:18017861-18017883 ACTCCTGGGTGGGAGATGAGCGG + Intronic
1145976352 17:28986359-28986381 CCAGCTGGGTGAGGGTGGAGCGG + Intronic
1146836904 17:36118271-36118293 TCTGCAGGGTGGCCGTGGAGAGG + Intergenic
1147152820 17:38528130-38528152 CCTTGTGGGTGGGTGAGGAGTGG - Intergenic
1147312527 17:39604036-39604058 GCTGGTGGGTGGGCGGGGAGAGG - Intronic
1148798990 17:50211220-50211242 CATGCTGGGAGGGGGTGGAGAGG - Intergenic
1148907450 17:50920197-50920219 CCTGCTGGGCCGGGGTGGAGAGG + Intergenic
1150397045 17:64830127-64830149 CCTCCTGGGAGTGGGTGGGGTGG + Intergenic
1150469105 17:65421130-65421152 GCTCTTGGGTGGGTGTGCAGTGG - Intergenic
1150614205 17:66756326-66756348 CCTCTTGGGTGGGAGAGGATGGG - Intronic
1151785104 17:76271611-76271633 CTTCCTGGGAGGGCCTGGGGGGG - Intergenic
1151964506 17:77424445-77424467 CCACCTGGGTGGGAGGGAAGGGG + Intronic
1151992131 17:77582129-77582151 GCTTCTGGGTGGGGGTGGGGGGG + Intergenic
1152079364 17:78176899-78176921 TCCCCTGGGTGGGAATGGAGAGG + Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152918003 17:83051898-83051920 CCTCCCGGAGGGGCGTGGAAGGG + Intergenic
1152939104 17:83156762-83156784 CCACGTTGGTGGGTGTGGAGTGG + Intergenic
1155175485 18:23298042-23298064 CCTGCTCGGTGCGCTTGGAGAGG - Exonic
1157583110 18:48784654-48784676 CCTCCTGGGAGAGCCAGGAGAGG + Intronic
1158505944 18:58045402-58045424 CCTCCAGGGTGGGTGGGGAGAGG + Intronic
1159040455 18:63319568-63319590 TCTCCTGGGGAGGCGTGAAGCGG - Exonic
1160012193 18:75114510-75114532 AGCCCTGGGTGGGTGTGGAGTGG + Intergenic
1160376140 18:78414195-78414217 GCTCCTGGGTGGCCTGGGAGAGG - Intergenic
1160491950 18:79345496-79345518 CCTTCTGGGTGGGTGAGCAGCGG - Exonic
1160680107 19:408495-408517 CCGGCGGGGTGGGGGTGGAGGGG + Intronic
1160864904 19:1252216-1252238 GCTCCTCGGTGGGGGCGGAGGGG - Intronic
1160889596 19:1370331-1370353 CCTCCTGGTTGGTGGAGGAGTGG + Intronic
1160909386 19:1467792-1467814 CCTCCTCAGTGGGCGTCGTGAGG - Exonic
1160994563 19:1876691-1876713 CCTGCTGGGTGGGCGCGATGAGG - Intergenic
1161225978 19:3146162-3146184 CCTCCAGGGTTGGCGTGCAGAGG - Intronic
1161273819 19:3404593-3404615 CCTCCTGGGTGGGGTGGGGGTGG - Intronic
1161663245 19:5560050-5560072 GCCCCTGGGTGTGCCTGGAGGGG - Intergenic
1161748610 19:6077412-6077434 CCTCTTGGGTGGGCTGGGGGAGG - Intronic
1162035262 19:7934966-7934988 GCTCCTGGGTGGGGGTGGCTTGG - Intronic
1162140142 19:8580634-8580656 CCTCCAGGGTGGGTCTGGGGAGG - Exonic
1162267109 19:9584642-9584664 CTTCCCGGGTGGGCGCGGACAGG + Intergenic
1162281441 19:9701155-9701177 CCTCCTGGGTGGGTGCAGACAGG + Intergenic
1162568443 19:11457220-11457242 CCTGTTGGGTGGGGGTGGGGAGG - Intronic
1162589319 19:11580167-11580189 CCTCCTGGGTTGGAGTGCAGTGG - Intronic
1163117037 19:15195305-15195327 ACTCCTTGGTGGGCTTGGGGAGG - Intronic
1163244066 19:16081795-16081817 ACTCCTGGGTGGGCTTTGACGGG + Intronic
1163390165 19:17026169-17026191 TCCCGTGGGTGGGCGTGGTGAGG - Intronic
1163590919 19:18193688-18193710 CCTCCTGGTGGGGCTTGTAGTGG + Intronic
1163786061 19:19275512-19275534 CCCACTGGGTGTGTGTGGAGGGG + Intergenic
1163799461 19:19355919-19355941 CCTCCTGGGAGGGCAGGGACTGG - Exonic
1164012683 19:21219702-21219724 TCACCTGGGTTGGAGTGGAGTGG + Intergenic
1164880677 19:31730269-31730291 TCTCCTGGGTGGGCATGGTATGG + Intergenic
1165163394 19:33832097-33832119 CCCCCTTGGTGGGGGAGGAGAGG - Intergenic
1165324689 19:35107653-35107675 CTTCCTGGAAGGGGGTGGAGTGG - Intergenic
1165347632 19:35258852-35258874 CCTCCTGGGTGTGCTGGGAAGGG + Intronic
1165800463 19:38546358-38546380 CCTGCTGGGTAGGTGAGGAGGGG + Intronic
1165811827 19:38616518-38616540 CCTCCTAGGTTGGCGTGGGACGG - Intronic
1166746833 19:45145700-45145722 GCTGCTCGGTGGGTGTGGAGGGG - Exonic
1166942551 19:46375585-46375607 CCACCTGGGTGGGAGGGAAGGGG - Exonic
1166965447 19:46527069-46527091 CCACCTGGGTGGGAGGGAAGGGG + Exonic
1167359245 19:49021062-49021084 CCACCTGGGTAGGCGGGGTGTGG + Intergenic
1167703540 19:51065243-51065265 CATCCTTGGTGGGGGTGCAGTGG + Intergenic
1167978845 19:53255493-53255515 CCTCCTGGGTGACTGGGGAGCGG - Intergenic
1168403856 19:56100733-56100755 CATCGTAGGTGGGGGTGGAGTGG - Intronic
1168403878 19:56100825-56100847 CATCGTAGGTGGGGGTGGAGTGG - Intronic
1168403923 19:56101009-56101031 CTTCGTAGGTGGGGGTGGAGTGG - Intronic
1168403963 19:56101179-56101201 CATCGTAGGTGGGGGTGGAGTGG - Intronic
925177170 2:1793877-1793899 ACTCCTGGGTGGGCCTCGAAGGG + Intronic
925187808 2:1861154-1861176 ACTCCTGTGTGTGCCTGGAGGGG + Intronic
925977470 2:9151111-9151133 CCACCTGAGTGAGTGTGGAGCGG + Intergenic
926528095 2:14008000-14008022 CATGCTTGGTGGGGGTGGAGGGG - Intergenic
926698558 2:15787445-15787467 TCTCCTGGGTGGGAGGAGAGGGG + Intergenic
927070952 2:19529028-19529050 CCTCCTAGGGGGTCGTGGAGGGG - Intergenic
928823547 2:35391853-35391875 CCTCCTGGGTGGGAAGGGAGAGG - Intergenic
934079195 2:88452742-88452764 CCTCCTGGGCCGGCCCGGAGCGG + Intergenic
935057045 2:99576896-99576918 CCCCCAGGGAGGGCATGGAGTGG - Intronic
935684423 2:105670971-105670993 GCTCCTGGTGGGGAGTGGAGAGG - Intergenic
936527476 2:113251353-113251375 CCTCCTGGTTGGGCGGGAAGTGG + Intronic
937042621 2:118833997-118834019 CCTGCAGGGTGGCCTTGGAGAGG - Intergenic
937295568 2:120807898-120807920 CCTTCTGGGTGGGCAGGGTGGGG + Intronic
937901689 2:127024867-127024889 CCTCCTGGGAGAGCGTGGGATGG - Intergenic
937957072 2:127427499-127427521 CCTCATGAGTGGGAGTGGAGAGG - Intronic
938560862 2:132470762-132470784 CTTCCTGGGTGGGCGGGGGAGGG + Intronic
938732816 2:134159736-134159758 CCTCTGGGGCGGGAGTGGAGAGG - Intronic
938806859 2:134814199-134814221 CCTCTTTGGTGGGCAGGGAGAGG - Intergenic
939617488 2:144377551-144377573 ACTCATGGGTGGGCGGGCAGTGG + Intergenic
940639486 2:156332225-156332247 CCTCATTGGTGGACGTGGAAGGG - Intronic
941987418 2:171522748-171522770 CCTCCTGGGGGGGTGCGGGGAGG + Intronic
942505462 2:176637678-176637700 CCTCGTGCGTGGGCGGGGATCGG + Intergenic
942816338 2:180058232-180058254 CCTCCTGGGTGACGGGGGAGGGG + Intergenic
943874421 2:193044715-193044737 TCTCCTGGGTTGGAGTGCAGTGG - Intergenic
944914440 2:204343849-204343871 ACTCCTGGTTGGGGGTGGGGAGG - Intergenic
945240356 2:207671058-207671080 CTTCCTGCGGGGGCGGGGAGCGG + Intergenic
946030112 2:216696794-216696816 CCTGCTGGGTGGACTTGGTGTGG + Intergenic
946419849 2:219558459-219558481 GCTGGTGGGTGGGCATGGAGAGG + Exonic
946908932 2:224442222-224442244 CCTCCCGGGTTGGCGGGGGGCGG - Intergenic
947253663 2:228137086-228137108 CTTCCTGGGTTGGAGTGGGGTGG - Intronic
947546112 2:231011580-231011602 CCTCAAGGGTGGGGGTGGGGAGG - Intronic
947765489 2:232634562-232634584 CCTCCTGGGGGCGCGGGGAGGGG + Intronic
948624707 2:239261850-239261872 CCTCCTGGCTGGGCCGGGTGGGG - Intronic
948742944 2:240060155-240060177 CTCCCTGGGTGGGCGTGGGAAGG - Intergenic
948767048 2:240227863-240227885 GCTCCTGGGAGGGCGGGGACAGG - Intergenic
948920717 2:241064734-241064756 CCTCCTGCGTGGGTGTGGAGGGG - Intronic
948948804 2:241235843-241235865 CCTCCTACGTGGGCCTGAAGGGG - Intronic
949001824 2:241619138-241619160 CATCCTGGGTGGGAGTGGAAAGG + Intronic
949041400 2:241851586-241851608 CCACCTGCGAGGGCGTGGGGTGG - Intronic
1168831402 20:847048-847070 GCCCCACGGTGGGCGTGGAGAGG + Intronic
1168908909 20:1429423-1429445 CCTCCAGGGTTGGGGTGGAGTGG - Intergenic
1169051508 20:2582513-2582535 TCTCCTGGGTTGGAGTGCAGTGG + Intronic
1170559836 20:17547427-17547449 CCTCCTGGGATGGTGTGGATTGG + Intronic
1171439416 20:25148460-25148482 TCTCCCAGGTGGGCTTGGAGGGG - Intergenic
1172482356 20:35278279-35278301 TTTCCTGGGTGGGCGTGGGGCGG - Intergenic
1173845989 20:46189102-46189124 CCTCCTGGGGGGGCGGGCGGCGG + Intronic
1173888682 20:46485156-46485178 CCTCCTGGTGGGGGTTGGAGGGG - Intergenic
1174139223 20:48400961-48400983 CCTCCTGCGTGGGAGTGAACAGG + Intergenic
1174453830 20:50636078-50636100 CCTCCCGGCTGGGCCTGGTGGGG + Intronic
1174498890 20:50969630-50969652 CTTCCTGGATGGGCGTGGGAAGG + Intergenic
1175160114 20:57002167-57002189 CCTCCCTGGTGGGTGTGGGGTGG - Intergenic
1175800712 20:61799744-61799766 GCTCCTGGGTGGGCAGGGCGTGG + Intronic
1175860472 20:62147718-62147740 CCTGCTGGGTGGGTTTGGTGTGG + Intronic
1175994056 20:62804617-62804639 CCTCCCGGGTGGGCATCGTGGGG + Intergenic
1176423404 21:6533401-6533423 CCTCCTGGGGTGGCGAGGGGGGG - Intergenic
1177167778 21:17622274-17622296 CCTCCTGGGCTGGGGTGGGGTGG - Intergenic
1178355743 21:31909395-31909417 TCCCCTGGGTGGGCGTGGGAGGG + Intronic
1179698898 21:43141717-43141739 CCTCCTGGGGTGGCGAGGGGGGG - Intergenic
1180230719 21:46425392-46425414 CCTCCTGGGTGGCCATCGTGTGG + Intronic
1180843887 22:18971194-18971216 CCTCCAGGGCGGGCGGTGAGAGG + Intergenic
1181057587 22:20267512-20267534 CCTCCAGGGCGGGCGGTGAGAGG - Intronic
1181713298 22:24705361-24705383 CCTCCTGGGTGGGAGAGGCTTGG + Intergenic
1181988199 22:26816443-26816465 CCAAGTGGGTGGCCGTGGAGGGG + Intergenic
1182123288 22:27800233-27800255 CTTCCCGGGTGGCCGTGGTGAGG + Exonic
1182277037 22:29196151-29196173 CCTCCTGGGAGAGCACGGAGGGG + Intergenic
1182681389 22:32082618-32082640 CCTCCTTGGTGGGGGTGGGAGGG + Intronic
1182782659 22:32880528-32880550 CCTGGTGGGTGGTGGTGGAGAGG + Intronic
1183062710 22:35345797-35345819 CCTGCTGTGTGGGTGAGGAGTGG - Intronic
1183299503 22:37051956-37051978 CCCCCGGGGTGGGCGGCGAGCGG + Intronic
1184458731 22:44625545-44625567 CCTCCTGATGGGGTGTGGAGAGG - Intergenic
1185343516 22:50301711-50301733 CCCCCGGGGTGGGCGTTGGGGGG + Intronic
949601275 3:5600705-5600727 CCTACTGGGTGGGGCTGGGGTGG - Intergenic
949892885 3:8746198-8746220 TTTCCTGAGTGCGCGTGGAGAGG - Exonic
950364445 3:12473159-12473181 CTTCCTGGGTGGGCTGGAAGAGG - Intergenic
950699082 3:14727599-14727621 CCCCCTGGCTGGGCATGGAGGGG + Intronic
953352274 3:42224181-42224203 CCTACAGGGTGGGCGAGGTGAGG - Exonic
953606305 3:44415349-44415371 CCTCCAGGGTGGGCACAGAGGGG + Intergenic
953999759 3:47546791-47546813 CCTCCTGGGCTGGAGTGCAGTGG - Intergenic
954102353 3:48384548-48384570 CCTCCTGTGTGGCACTGGAGTGG + Intronic
954396667 3:50296795-50296817 CTTCCTGGGTGGCCGGGGAGAGG + Exonic
954661672 3:52229941-52229963 CCTCATGGGTGTGCTTGTAGAGG + Exonic
954693170 3:52406628-52406650 GCTCCTGGGTGGGCTGGGGGAGG - Intronic
954796226 3:53162283-53162305 CCTCCTGGCTGGTGGTGGAGCGG + Intronic
955655810 3:61243713-61243735 CCTCATAGCTGGGGGTGGAGTGG - Intronic
955839586 3:63097528-63097550 CCTCCTGGGTGCGCATGGCCTGG + Intergenic
956505090 3:69929379-69929401 GCTCCTGGGGTGGGGTGGAGTGG + Intronic
961393446 3:126570219-126570241 CCTCCTGGGTGGTCACGGGGTGG - Intergenic
961723033 3:128908636-128908658 CCCCTAGGGTGGGGGTGGAGGGG - Intronic
962371265 3:134822608-134822630 TCTCCAGGGAGGGCTTGGAGTGG - Intronic
962534385 3:136314613-136314635 CCACCTAGGTGGGAGTGCAGTGG - Intronic
962685076 3:137839833-137839855 CACCCGGGGTGGGGGTGGAGTGG + Intergenic
963534919 3:146515002-146515024 CCTCCTGGGAGGGAGTGCACAGG - Intergenic
966851566 3:184168095-184168117 TCTCCTGGCTGGGAGTGGGGAGG + Intronic
968047017 3:195630191-195630213 CATGCTGGCTGGGCGGGGAGGGG + Intergenic
968089045 3:195888690-195888712 CCTTCCGGGTGGCCGTGTAGTGG - Intronic
968307634 3:197659853-197659875 CATGCTGGCTGGGCGGGGAGGGG - Intergenic
968633146 4:1662836-1662858 CCACCTGCATGGGTGTGGAGTGG - Intronic
968909329 4:3469545-3469567 CCTCCTGGGAGGGTGTGGCTGGG + Intronic
968949398 4:3682821-3682843 CCTCCTGGGTGTGCTTTGGGAGG - Intergenic
968983118 4:3861322-3861344 TCTGCTGTGTGGGGGTGGAGGGG + Intergenic
969311286 4:6354220-6354242 CCTCCTCGGTGGGGTGGGAGAGG - Intronic
969531631 4:7733877-7733899 CGTCCTGTGTGGCCTTGGAGAGG - Intronic
971194860 4:24462918-24462940 GCTCCTGGGTGAAGGTGGAGGGG - Intergenic
972718530 4:41673349-41673371 CCCCCTGGGTAGGGGTGGAGAGG + Intronic
976002456 4:80388053-80388075 ACTCCTGGCTGGGAGTGGAATGG - Intronic
977714574 4:100167464-100167486 ACTCCTGGGTGTGCATGCAGTGG + Intergenic
984474010 4:180214704-180214726 CCTTGGGGCTGGGCGTGGAGGGG + Intergenic
984891908 4:184501904-184501926 TCTCCTGGGTGGGAGAGGGGAGG - Intergenic
984923407 4:184785591-184785613 CCTCCTGGGCGGGGGCGGGGGGG + Intronic
985340727 4:188950517-188950539 CCTCCTGGGCTGGAGTGCAGTGG + Intergenic
985651489 5:1109740-1109762 ACTGCCAGGTGGGCGTGGAGAGG - Intronic
986768074 5:10946211-10946233 CCTTCTGAGAGGGAGTGGAGAGG - Intergenic
988934033 5:36065228-36065250 CCTGCGGGGTGGGGGTGGAAGGG + Intronic
995433517 5:112109417-112109439 CCTCAGGGGTGGGCGTGGCATGG - Intergenic
995798034 5:115962284-115962306 CCTCCAGGGTTGGCGCGGGGAGG - Intergenic
997229577 5:132232737-132232759 TCTCCAGGGTGGGCATGCAGTGG - Intronic
997297045 5:132775001-132775023 CCTCCTGGAAGGGCTTGGATAGG - Intronic
997346395 5:133195457-133195479 CCTCCTGGCTGGGGGTGGAGGGG + Intergenic
997515161 5:134482999-134483021 CCTCCTGGGTTGGAGTGCAATGG + Intergenic
997515175 5:134483093-134483115 CCTCCTGGGTTGGAGTGCAATGG + Intergenic
997515188 5:134483187-134483209 CCTCCTGGGTTGGAGTGCAATGG + Intergenic
997515201 5:134483281-134483303 CCTCCTGGGTTGGAGTGCAAAGG + Intergenic
997515270 5:134483800-134483822 CCTCCTGGGTTGGAGTGCAATGG + Intergenic
997515284 5:134483894-134483916 CCTCCTGGGTTGGAGTGCAATGG + Intergenic
997515297 5:134483988-134484010 CCTCCTGGGTTGGAGTGCAATGG + Intergenic
997515310 5:134484082-134484104 CCTCCTGGGTTGGAGTGCAATGG + Intergenic
1001381143 5:171307482-171307504 CCTTCCTGGTGGGTGTGGAGAGG - Exonic
1001426919 5:171628935-171628957 CCTCTGGGGTGGGCTTTGAGGGG - Intergenic
1002475391 5:179462191-179462213 CCTGCAGTGTGGGCGTGGTGGGG - Intergenic
1002581493 5:180211838-180211860 ACTCCTGGGTGGGCTATGAGGGG - Intergenic
1002866634 6:1127688-1127710 CCATCTGGGTGGCCGAGGAGAGG + Intergenic
1003175441 6:3750417-3750439 CCGCCTGGGAGGGCCGGGAGGGG - Intronic
1004577222 6:16909009-16909031 CCTCCTGGCTGGGCATAGAGAGG + Intergenic
1005949313 6:30619662-30619684 ATTCCTGGGTGGGAGTGTAGTGG - Intronic
1007118542 6:39361760-39361782 TCTCCTGGGTGTGCGTCGGGGGG + Intronic
1007397192 6:41584719-41584741 CCTCCTGGGTTGGGGTCCAGGGG + Intronic
1007930335 6:45685253-45685275 ACTCCTGGGTGGTCCTGCAGGGG + Intergenic
1008218247 6:48822525-48822547 ACTTCTGGGTGGGTGGGGAGGGG + Intergenic
1012033121 6:94098498-94098520 CCTCTTAGGTTGGGGTGGAGAGG - Intergenic
1013550290 6:111201292-111201314 ACTACTGGGTGGGGGTAGAGGGG + Intronic
1015354035 6:132255907-132255929 CCTCTGGGCAGGGCGTGGAGAGG - Intergenic
1016372947 6:143393284-143393306 CCTGCTGGCTGAGCCTGGAGAGG + Intergenic
1017021575 6:150143729-150143751 CCCCCTTGGTGGCCGTGGGGAGG + Intronic
1017716861 6:157218909-157218931 ACCCCTGGGTGAGCGAGGAGTGG + Intergenic
1018184640 6:161256059-161256081 CTGCCTGGGTGAGGGTGGAGTGG - Intronic
1019198289 6:170295280-170295302 CCACTTGGGTGGGCGTGGCTGGG - Intergenic
1019271453 7:151317-151339 CATCTTGGGTGGGGGTGGGGAGG - Intergenic
1019281679 7:203425-203447 CTTCCTGGGTGGGAGGGCAGGGG + Intronic
1019543455 7:1561475-1561497 CCTCCTGGGTGGGCGGGGTGAGG + Intergenic
1019645898 7:2128813-2128835 GCTCCTGGGGAGGCGTGGTGTGG - Intronic
1020139272 7:5603812-5603834 CCTCCTGGCAGGGAGTGGGGTGG - Intronic
1023059068 7:36312016-36312038 CCTCCTGGGAGGACCTTGAGTGG + Intergenic
1023725313 7:43137217-43137239 CCTGCTGGGAGGGAGGGGAGAGG - Intronic
1024634437 7:51275706-51275728 CCTCCTGGGTGGGCTGCGTGCGG - Intronic
1025734122 7:64131921-64131943 GCTCCAGGGTGGCCTTGGAGTGG + Intronic
1029109841 7:98207428-98207450 CCTCCTGTGTAGGCATGGGGTGG + Exonic
1029536133 7:101159040-101159062 ACACCTGGGAGGGCGGGGAGAGG - Exonic
1029746255 7:102517283-102517305 CCCCCGGGGTGGGGTTGGAGGGG - Intronic
1029764193 7:102616262-102616284 CCCCCGGGGTGGGGTTGGAGGGG - Intronic
1032487176 7:132296740-132296762 CCTCAGAGGTGGGCTTGGAGTGG + Intronic
1033742363 7:144284768-144284790 CCTCCTCTGTGGGGGAGGAGGGG + Intergenic
1033751539 7:144364846-144364868 CCTCCTCTGTGGGGGAGGAGGGG - Exonic
1034467821 7:151240135-151240157 CCTGCTGGTTGGCCGTGGATAGG + Exonic
1035045064 7:155960166-155960188 CCTCCGGGGTGGGTTTGGAGCGG + Intergenic
1035235804 7:157497074-157497096 TCTCCAGGGTGGGCAGGGAGGGG - Intergenic
1037838676 8:22229283-22229305 CCTCATGTGTGGGGGTGGAGGGG + Intronic
1040408489 8:47132802-47132824 TTCCCTGGGTGGGCGTGGGGTGG - Intergenic
1041089857 8:54291930-54291952 GCTCCCAGGTGGGAGTGGAGTGG + Intergenic
1041176904 8:55206403-55206425 GCTCCTGGGTGGGTGGGGACTGG - Intronic
1041254208 8:55965357-55965379 TCTCCTGGGTGGGGGAGGAGTGG + Intronic
1042865918 8:73356720-73356742 CTTCCTGGGTGGGTGGGGACTGG - Intergenic
1047784648 8:128142122-128142144 CCTCCTTGCTGGGCGAGCAGGGG - Intergenic
1048979244 8:139694308-139694330 CCTCCTGGGTGGAGGAGGCGAGG + Intronic
1049240457 8:141535195-141535217 GCTTCTGGGTGGGCCTGGATAGG + Intergenic
1049379413 8:142304592-142304614 CTTCCTGTGTGGGCCTGGGGAGG + Intronic
1049512935 8:143038878-143038900 GCTCCGGGGTGGGCGGAGAGTGG + Intergenic
1049555352 8:143278756-143278778 GCTCCTGGAGGGGCGGGGAGGGG + Intergenic
1049676761 8:143892782-143892804 CCTCCTGGGTGAGCGTGGCTGGG - Intergenic
1049775001 8:144400074-144400096 CCTCCTGGGTGCCTGTGGGGTGG + Exonic
1055744425 9:79427117-79427139 TGTCCTGGTTGGGGGTGGAGGGG + Intergenic
1056072508 9:83003219-83003241 CCTTCTGGGTGTGTGTGGGGGGG - Intronic
1056125214 9:83529939-83529961 CATCCTAAGTGGGTGTGGAGTGG - Intronic
1057437670 9:95057341-95057363 CCACGTGGGTGGAAGTGGAGTGG + Intronic
1059407397 9:114109750-114109772 CCTCTGGGGTGGGGGTGGCGGGG - Intergenic
1060050638 9:120375994-120376016 TCTCCTAGGTGGGCTGGGAGTGG - Intergenic
1060845927 9:126837538-126837560 CCTCCTGGGTGGGCGTGGAGAGG + Exonic
1061383682 9:130275935-130275957 CCTGATGGGTTGGCGGGGAGTGG + Intergenic
1061491842 9:130949253-130949275 CCTCCAGGAAGGGCATGGAGTGG + Intergenic
1062189812 9:135242229-135242251 CTGCCTGGGTGGCCTTGGAGGGG - Intergenic
1062199523 9:135294523-135294545 AATCCTGGGTGGGCTTGGGGTGG - Intergenic
1062436185 9:136547554-136547576 CCTGGTGGGTGGGGGTGGGGTGG + Intergenic
1062653666 9:137590913-137590935 CCCTCTGGGCGGGCGGGGAGCGG + Intergenic
1186506794 X:10100265-10100287 CCACCTGGGTGGGCCTGCACAGG + Intronic
1186666283 X:11720657-11720679 CCACCTGGGTGGGGGTAGGGTGG - Intergenic
1187473343 X:19588603-19588625 CCTCCGGGGCGGGTGTGGGGTGG - Intronic
1188360118 X:29242977-29242999 CCTCCCAGCTGGGCCTGGAGAGG - Intronic
1189262751 X:39689584-39689606 GCCCCTCGGTGGGGGTGGAGGGG + Intergenic
1194199470 X:90937185-90937207 CATCCTGGGTGGGTGTGAAGTGG + Intergenic
1196106223 X:111898865-111898887 TCTCCTTGGTGGGGGAGGAGTGG - Intronic
1196670166 X:118357767-118357789 CCAGCTAGGTGGGCGTAGAGGGG + Intronic
1197458461 X:126707592-126707614 GCTTGTGGGTGGGGGTGGAGAGG + Intergenic
1198156848 X:133969095-133969117 CTTCAGGGGTGGGGGTGGAGCGG + Intronic
1198311157 X:135426421-135426443 GCCCCTGGGTGGGGGTGGGGAGG + Intergenic
1200236360 X:154469609-154469631 CCTCCTGGGTGTGGGTGGGTGGG + Intronic
1200545463 Y:4513605-4513627 CATCCTGGGTGGGTGTGAAGTGG + Intergenic
1201909992 Y:19124332-19124354 CCTGCTGGGTGGGTGTGCACAGG - Intergenic