ID: 1060847411

View in Genome Browser
Species Human (GRCh38)
Location 9:126848381-126848403
Sequence AAGTAAAGACAGATGATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060847411_1060847417 15 Left 1060847411 9:126848381-126848403 CCCAGCATCATCTGTCTTTACTT No data
Right 1060847417 9:126848419-126848441 TTAGGTCGTGTACTGCACACAGG No data
1060847411_1060847413 -3 Left 1060847411 9:126848381-126848403 CCCAGCATCATCTGTCTTTACTT No data
Right 1060847413 9:126848401-126848423 CTTAGAACCCCATAAAGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060847411 Original CRISPR AAGTAAAGACAGATGATGCT GGG (reversed) Intergenic
No off target data available for this crispr