ID: 1060847411 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:126848381-126848403 |
| Sequence | AAGTAAAGACAGATGATGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1060847411_1060847417 | 15 | Left | 1060847411 | 9:126848381-126848403 | CCCAGCATCATCTGTCTTTACTT | No data | ||
| Right | 1060847417 | 9:126848419-126848441 | TTAGGTCGTGTACTGCACACAGG | No data | ||||
| 1060847411_1060847413 | -3 | Left | 1060847411 | 9:126848381-126848403 | CCCAGCATCATCTGTCTTTACTT | No data | ||
| Right | 1060847413 | 9:126848401-126848423 | CTTAGAACCCCATAAAGTTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1060847411 | Original CRISPR | AAGTAAAGACAGATGATGCT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||